Description :
From Genome Similarity Track
Location :
Scaffold_2:331366- 335964
Transcript NameFunction/comments
Phyin_T30-4PITG_01197Putative uncharacterized protein

Sequence
4598 bases(100 bases per row)
TGTACAGAGTCCGCCTCTTGATCGCATGGGGGGGCAGACGCAGCCCCAAACCGGAGAGCAGGGCTCTACGCGATCTAATCACTGACCTCGACCTGGAAGA
CGCCGTCACCCTAGAAGGCGTAGCAGGAACTGATGACGCGGACCCAGACCCGACGGAATTTTATACCTATTGGGGAGCGGGCAGCGCCAGTCGGATCGAT
CGCTTTTACGTTCCGTCAGCTTGGACGGCAGACATACAGTGCGTGGAAGTTCGAGAGCCAGAAGTACAGTCCGATCATCAGTGTGTATGCCTGCACCTGC
AGCATGACAGGATACAACCGAAGCAAGGAAACCGGTCAACACGGCGTGTCACGTACCCCATCAGGACTTCTAGACACACTGTGTTGCAACGGGAACTCAT
GAAGGAACTAATAGAGCAGGGAGTTGGCTATCAAGTCACGAGCAAGTCATGGGACCACGCGGCCGAAGCTTGTGTACGCAGCATTAGGATTATCCAAAAG
CGCGAACGCAAGCGTCGAAAACGAATGAAACAACGGTTGAAAGCCCAAAACAGGGCCCACCTCCTCACCAGGCGGGGCTTCTTACAAGCAAATGAAGAAG
ATGCTCGTGAGGAACAGCTTGTACGACTAGGTCAGCGCCTGGAACGGACAATGGACCAACTGCGTTGGAATTTTAAGTGGATCTCCAACTGGGAGAAAGA
TCAATCAATTGCAGAGATTCATCACCTCCATGGAGACCGATTTCACAGAGAAATGAAGATAGCAGACAAATTTGGCTCTGAATGGAAACCAATCCTCGGA
GTTGTTCATAGTACTGTTCCTCCAAACAGACTGCAGGAGGAATTCGACAAATTTGTACACATTCCTGGAGATCGGCAGATAACACCGCAACAAAATGAAG
AATTAATGGCTGAAATCACGATTGATGAGGTCCTCGGAGCCATTGCCGAACTCAATCGACACAAAGCGGCCGTCCCCGATGGGTTAAACAATGACTTCTT
CAAGGACGTTCAGCCGGTCCTTGCTCCAGCAATGGTAGTGATAGGAAACGAGTTACTGGCGGGAGCGGAACCGCCTCCCTCCTTCCTGGTGGGTTTGATT
ATTCCTCTCAGGAAGAAAGGAGACTCGGTAGATGCCATGGACTTCAGACCAATCTCACTTCTACAGACCGCGTACAAAGTCTTCATGAAAGTAATGGCGT
GCAGGATGCAGAAAGTTATCGGTAAACCGATCGGCGACTCACAACAGGGATTCGTGCACGGTCGACAGATGATGAAGACTGTCATGATGATGCTGGCTGG
GACCGCCACGGCTCGAGGAGAACCGGTACTCTCGGCATTGTTAAGTCGAGTTATTCTCCTTCTCGACTTCAGAAAAGCTTATGATACCGTCTCGCGGGAA
TTCCTGTTTCTGGCGTTACTAAAGTTTGGATTTTCAGTAGAATTTGTGAATCTCTTACGGCGGCTGCATGATGGCACAGCGGCAAGATTTCTTGTAAATG
GAGAACTCTCCGAATCGCAGGCAGTTGTCTCGGGTATCCGTCAAGGTTGTCCAGTAGCCCCGTTACTGTTTATAATTGCGGCGGAAGTATTAGCACTGGC
GATGAAGCAGGACACCACACTGAAAGGGCTGGAAGTCCCAGGAACAGGAGGACAGCGGCACTTATTCTCTGCGCTCGTAGATGACTCAACAGTATTCCTG
CAGCATGCTCACCAGATCCCTAAAGTATTGAATATCGTAGAACGCTTCGGTCAACTCTCGGGTCTGCAGGTGCAACCAGCCAAAAGTCAGCTCATCTTCT
TAAACAAGGCGATCGAAGAACACCAGTTCTTCGGCCTACCGGTCCTTCGAGGAGGTGACACCGTCCGATATTTGGGCTATCAAGTGGGCACAGGGCCGTT
GACAGACATCAACTGGGCAGGCAGGATTCGCAACATCCAAAGACGGTTAGCGACGGCAACGAAGTTAAGAACAAGCATCGACCATTGGATCACCATCCTG
AACGTCATTATGCATCCCTCGGTTCTATTCACAGCAGCGGCCTTCGACATGCCTAAATGGGCAGACAAGCAACTCAGGAATCTGCAAAAACAATTTCTGT
GGAGGCATGCAACGGCAACAGAGAGTACCCGTCACAAGGTCGCTCCAGGCCTAGTCTTCGCACCTAAACAGGCAGGAGGAATGGGACTCGTCTCAATCCC
CGTGGCGTGCAAGACCCAGAGGGTAAAACAACGATCCTCTGACTAGTCCAACGCAAAGACTCGTACTGGCAGGCGTGGAAGCATTGGATGTTCCGAGGGA
CATCACCTGCTTGGGAGAATACACTTACGCCCAGAAACAAGCTCACACGATCCTTGCACTCAGCGGGAGTATCACCAGGAGACAAATTACACCAGCTAGT
CGGTGAATGTTTTCAACCCACCGCAGAGTTGGAAGGCGAGGCTATACTGGAATACCAGATAGCACTTAATGAACTAGAACTGGAATCGATCAGTTGGACT
GCAGCGGGGACGTGGATCACCGAGCTACCATGGGAGCTCGGGTGTACACAACGCGAAATGAGTACACAAGAAGAACTCTACTGGCCGGCGTACACGTGGA
ATGACAACCCGTGGATTGTCGATAACCTAGGCAGAACCCTGAGTGCCAAGACGTTCAACCGAATCCAACCTTGCACGTTGGAAGAGCTTCAGATCACACG
AATAAGCTCGAAAACGTACTCCCTCAGCATACCGGTCGCTGGGGAGGAGGAGCACCAACAGGCAAAGCGACGGAGGTGGGGTCTGGCGATCTTGATGAAC
GCCCCGGCCCTACCCATGGGAGCAACATTGGCAATTACGAAAGAGCTCACTTTACGACACCCGCCAGAACTGGAAAATGAATATCGGTGGGAGTTGCAAC
CGGACGGCCTTGCAATAGGCACGATCGTCGTGGGGTCGGCGGCGGGAGCCAGTATCACCTTGGAATAGCAGAGCAACGGACTAGCTTGGACTCCAGTTGG
AGCAGATTACGGAAGGGAAGGCACATCAGCAGACATACGAGTGTTCCAAGCACTGGGAGCAGCAGGAAAGGTAGTCTTTTATGCTCACCCCAGCGTCCAG
AGTTGTCCGTGGAATGTTCAAGAAAGTATCGCGAATAACCATGTGCTGAAAGCACTTAAGCAGCAGCCGTTTAAACGGTACCGCAATGAAGTAGAACAGC
TTCAGCGACCAGTAGAGCGACTCCACGAGGTGGTAACCGGAAGCACCTGGCAACGCGCAGCGATGCACCAGACGCCAAAGCAAGTCTGGGCCCACAGAAA
TCAGCTTACGGAGTATCAAGTATGGGTAGCGTATCGAGTTGCGGTACGGCAGCTCAGCTTGTACCACGAAGGCAAGAAACATGACAGCAGTTGCAGAAAA
CCAGCAGCATGTCAAGGGCGAAAGGAAACGATGGAGCACATATTCTGGGAGTGCTCCTGCGCCCAGGCTTGTTGGGTGAAGCTCATCCAGCAGTGGACTG
GGGAAGCATGGGAGCCCCAAAACATCGAGAGCTTCCAATTGAGCTGCGCGAACAGGAAAGCGCCTCCCGTAACGCCCTCATTAGTGGAGAAGATGCAGAA
AACATACCCGGACGACATCAAGCACATCATACTGGAATGGAAACGCATCTGGCATATCCTGTGCACAATTTGCCTTACCAGCCTGTGGACACAGCGCAAC
AGGGTCGTCTTTCAACAAGCCCAGGTGACAGAGGACTCCAGTGCGACAGAATTTTGGGGGACGGCAATGCGTCAGTTGAGAGCGCTGGGGAAACGTGAAT
GTCGACAGCCGGAGACTCAATTGCGAGGAACTCATTTACTTCTATGCCTGCGGGTACTAGAACAAAAACCACGAGAGCACCCGAGACAGCGGGTGAGCCC
CGAACAACCACTGGACTTGCAAGAGGAACCGGCGTTGCTAACCAGGCTTAGGAAGTACCAGACAGCTAGTCGTCGTTAAGACCAAATAGAATGTCTGCCT
CTCTCTCTAACGCTACCCATCTATAAACCTTTGCTGGCACCACAATACATTGTGTTCGTCATTCATTGTTTGTACTGATTTTTATCTTTTGGAGAGTTTC
CATGTATTGCAGTCTCGACAACCCGGTTGACAGCCTCCAACCCAGGGCATGGGATTTATAGCGCATAATATCCAATTTTTGATTATGGATGAGCTATTCG
CCGATTTTGTTTACCTCGTTGCGCTTGGAAACTCATTTTCTATGGCATGTTGCTCTGCTTCTAATTTATTGTCGCAACCTTGACAATATCTCGTGGATCG
CGGCAGTGACGCACCAGCCTTTCTCAGATAATACACGTATCAAAAGAAAGCAGCTGGTGCTGAATTTACATCGCTAACGAACCGTGCCTGACCTCGCAAG
CTTCAAAAGAACCTGGGAGCATGTCAGATGTTGAAAAGACTGGGGCCAGCGGATTTACCTTGCTCGGGCATCCTGGCAAGGCATAGCCGCTTCCTTGCGT
GTTGTCGCTGTCGGTGCGATTAACAAAGGTCATCGCACCAACAAAAACGATGGCTTCCGCCTCACCCTCATAGCCATCGGCATTTACCTCAGTGCCAT