Description :
From Genome Similarity Track
Location :
Scaffold_33:331314- 333026
Transcript NameFunction/comments
Phyci_273808oligopeptidase A putative
Phyci_6421Hypothetical protein

Sequence
1712 bases(100 bases per row)
GGGAGGCTACGCCGCCGGCTACTACAGGTATGCGTTAACTGCTCATTGTCTTGACGCAAGGACACCCGACTGACTCGTGTAAACTGTACGCAGCTACAAG
TGGGCCGAGATCTTGTCGTGCGACGCCTACGGCGCCTTCGAGGAGGCGGCCAAGGAGAGCCCTGAGGCCGCAGCGCGCGTGGGTCGCCGGTTCCGCAACA
CGATCCTGGCGCGCGGTGGCGGCCAGCACCCGGAGCAGGTCTTCGAGGCCTTCCGCGGCCGCAAGCCGTCCGTGGTGCCGCTGCTCACGCAGTACGGCAT
GGCGGACAAGTAGTTGCAGTTGCAGGCAAGTTCAACATGGCGAAAAGTATCCATCACGGACTGACATAGAAATGGCTCCGTGCTGCTTCGTGAATGGACA
CCGATGGGTGCCACGCGTTTAACGCGCGAGCGAGTGGTCGCGGGGCTTTGAAGGTGGCTTTGCTCGCGCATGCAAAGCCCAAGTCAGCCGCAGTCCGCGC
CGCGGGTGCTGGCGCTACTGGTCGTGCTGGCGCGAAAAGAACACGGGCTCAGATACGCGACGCATCCCCCCTAATGCAACTTCAACACCACGCAACATTA
AGTCTCACAGGTTTCTTTAAACATAGAAGCAGCAAAGAGAAACGTATCGAAAAACTGTAAATTGCGCCTGAGTTTTTGTAATTTTACACTTTAGCGCTCC
AGCAATCGAGGAAACGGACCACACGGCAGACGCGTCATGCTGCCTGCATGTGTAGCATAACGGCACGATCGAGCCACGAGCTCGACTGCACCACAGCGAG
GGCTCGACGGCGGAGGATTGCAATCGTATCGATTACCTTTGGAGACATCGTGACGCGTGGCTACACTGGTGGGCCCTTTTCCTCTTCCGGCTGCCAGTAG
ACAGTAATGCAGCGTAGGCGCGCGTCTCCTCGTCGTGGGCCAGGCGATCTACCGCAGAACGCAGGGTATAGACGTCGGGATAGCCTCTAGCTCCGTGGTC
GCAGGGTCGGGCAAGTCCACGTCGACGAAGCCCGCGATGAAGGCGGCGTTGAGGGCAAGCCGCATGATGCAGAATGACGGCGTCTGCGAAAGCCATGCTG
GATCGAAGCCGAAGGTGGACCCGCGGATGACTCGAGCAAGCCTCACAGCCTAGCGTCCACGGATCGGTACCGCGGCGTTCGTCAGTTATTACATGGTAAT
AAAAAATCTGAAAACAATCTGCCCGGCGATCGCACAGTAGGCGCATGGAAACGTCGGGTTTCGCCCGGTACGTATGTTGAAGAGACCTCGGCGTATAATC
TCTCGCAGGTCACGGTTCCGTGTTTCTATGGCCGGGCGCGTGCACGCGCAGCAGCAGTCAAGCCTTTCAGCCGCTCATTATCGCATTGTCGGTGGAGTGA
CCGGATCACTTGCGCGCACCCCAAGACCAGAGCACCGGAAGCGAGCGCTCTACCCACATCCACCCAAGCTTTACTCACTACTAGTACTGTACTAGACGTT
GCAGTAGCTACAGTAGACCGGTTTCCCCACCCACCCACACATAACACACACCCATAAACTTCAACAAGATGCTGTCGCCGTCGCTGTCGTCGTCGCTGCC
GTCCCCCACCGTGCCGGCCATGTCGTCGCGCCTGCCGCACCTCAACTCGTTCGTGGTGCTGACCAAGAAGCCGTcgggccgccgcctcgcgcgccgccgc
ggcAGCATCGCC