Description :
From Genome Similarity Track
Location :
scaffold_86:33124- 34751
Transcript NameFunction/comments
Plaha_PHALS_12039Anaphase-promoting complex (APC)%2C subunit 5

Sequence
1627 bases(100 bases per row)
GCGATGCAAATGGTGCATGCGGCGCAGATGCTTGAATACGTGTTCGACTTGTAGCaatcaaaacttgagcatggAGATACGCAAAACCATACTCACTGCA
CATAGATTCTAAACGCTTAAGCAACTCAAGGCTTTGTACACTGTCACCAATCGCAGTTTTTAATAAAGCTTCAAAAAAGAGGGCTGCAAGATATGCAGGT
AAGTCTTTTCCCTGGGGAGATAAAGCCTGTACCGCTTCTAAATGATAACGTGCGCGTGTAAATTCTCCTCTTTGCAAAGCCCATAAAAAAAAGAGGTGGT
GCACGCTTCTCTGATATACCATGTTATTGAATAAATGACGGTTCTGCACGTTGTGATGGTCACCAGAAGCAACATCGACAAGAAAGTTAAGAGCTTGCTC
GTAGACATTTGAATCATCTTTTGACACTGTGAGCCTTGACAACGCCATTTGACTGATGATTTGCACAATTTCTCCAGTGCTAGCAGAATCTTTATAGCAT
AGAAGATGTATACGACTAAAGATTTGTGCGAGCGGAAAATGAGCATACACATTCCACTCTACGGCTGCAAATACCGTAATTTGTCCACTTAGCTTCCACA
CGGTATCGAGAAGAGCTTCTGCCGATTTAATCCAGTCTAGCCCAATGCCTCCGCATTTGCCACTATTGTCAACGTCAGAGCGTCTATCTGCTTGCATTTG
TGGTGCCATCATCGGCCGCGTGCCAGGTAAACACGAAGCTGGAGTACCTATCGAGGCAATGAGCTGTATGGTCTCTTGTAGACGCGCCCAGATGTGCAGA
GGCCGAGGAGCGGGTGCATGTGCAGCAATTCTGTGCGGAATATATTGTGACGCCGTCTGCACCGTTTCAGACTTCGCTATCAGGCCACGCAATAAAACAT
TTTCAGCTTCCGTCAAAATTGCCAGCACTTGCAACGACGGCAATCGTAACTCTTGGGCTCGATCTAGACAGCTGAAGATTAACTTCAAGACAGCCTTTTT
AGAACGTCCACACTTTTGATTAATGCAAATTAACCATGCCAACGAAAAGGCAACACATATATGATCTCCATGGTGTTGAGCTGCTCGAATTGCTTCTTGA
ATGCTTTCTTCAGCTGCAGTATAGTGATCAAACAGTATTTGTAAACCAGCCAAATTCAGTGCAGCATACTGGATGCCACTTCCTCGAAAGCACATTTCAG
CAACTTCCGACGACGTCAAGTCATTTTCTTTACGAGGCGAGAGAACATCATGGTACTGGTGTAAACTATCAAGTGCACCTTGATAATCCCGATCATTTAA
AAATGATAAATACCGTGCAAAGAGCACATTGGGGTTTGAACTATCCATCTTTGAGCGAAGCAGGCGTAGCTGTTCTCCCCTTGACTGAATCTCTACATGT
TGCCTTCTTTGACTTCCTTTCGTATCTCGGACGATATCATTCATTACATAATTTAGCTGGTCATTTGACCACACTGcaaagtcattgacttctaAAGCAG
CTTCTGGGGTGAGCAGCTTTTCAGACAGTATCTCtgaatcaaattttgaagctAAAGGCGTCACCATGTTGGATTGTGTTGAGCTCTCAGAAAGCGTAGC
GAGTTCTGATTTAATCGGTGATAATAA