Description :
From Genome Similarity Track
Location :
scaffold_30:33121- 34449
Transcript NameFunction/comments
g2247.t1 L-aminoadipate-semialdehyde dehydrogenase large subunit, putative

Sequence
1328 bases(100 bases per row)
ATAGCGTTGGCTGCTGTCATCACAGAAGAGGTGAAGGTCCTGGTGGTGGACCACAGCAGTCCCCTTGAATGTGCGATTGCTCACTCGGAACTTGAAGTCT
CCCTTGTTGTCAATTGCGCCACTGACCGAAAGACGCACTACTGGGTTGTCTTCACTGTTCAGCGCCACCTCGTACATGTTTTTAGACAAACACTTGACAG
ACACCGAAGAACTTTCATCGCCATGGTTCAGTTGAAGCCTTCTTTCGAGTGTGTCCAATGAGCGGAAATGCGCTAGCGAGTCATCGGTCCATGGGGAGTG
TAGCTCGGTACTCTGATTTCCACCAGAGTGGCGCTGGATTTGCTCAAGAAGAAGCAAACTCACAGCCCCCATCGCTGTAGCATAAGTTGGGTATGACCCC
AAAGGTCCGAGCACGTCGTCACCAAACTTATTCAGGAAGCTCGTGTCAACACCGCCTTTTCGGAACGCAGCATGATCCGCAGTGCGGGCTACGAACTCGA
TATTCGTCGGGAGGCCCACGATTTGGTACTGGTGAAGCGCCCTAACCATCTTGTCCAGTGCATCCTGACGACTATCACCGTGCGCGATCAGCTTGGCGAT
CATTGGGTCGTAGAAGATTGAAACTTCATCTCCTTCAATGATACCTGTGTCCACACGAACGTCTTTCGATACAGGAGGCAAGCGAAGATGTTGCAAAGTA
CCACTCCCGGGAAGGAAATCACTGTTGGAGCACAAAGCTCGTGCCAGTAAGTCTACGCATTTTGCAACAACAAAAAGCGAATAAGCTCGAAACGTACTTG
TATGGGTTTTCGGCGTAGATCCGTGCCTCAACAGCGTGGCCATGAATTTTCAGGTCCTCTTGGCGTATCGGAAGCTCTTGACCTGCGGCAACCATGAGCT
GCAGCTCAACCAAATCTTGCTGCGTGATCATTTCGGTGACGGGGTGCTCCACTTGGAGACGCGTGTTCATCTCCATGAAGTAGAATGACTCGTCCTCGTC
CAGAAGAAACTCGACAGTTCCGGCGCCAACGTAGCCCACAGCCTTCGCTGCAGCAACGGCAGCATCTCCCATTTTCTTGCGCAACGCTTTTGACATATTG
GGCTATTACAAACACACATCGCATCGTGTAAGTGAACAAGACAAAAGCTATGCATACACGGCAGAGCCCCACTTACAGCTGGTGCCTCTTCCAACACTTT
CTGATGACGTCGTTGCACGCTGCAGTCGCGTTCAAACAGGTGAATGACGTTTCCATGTTTGTCTCCGAAGATCTGGAGCTCCACATGCCGCGGCTTCGTT
AGATACTTCTCGATCAGCACTCGTCCGT