Description :
From Genome Similarity Track
Location :
Scaffold_36:331190- 334456
Transcript NameFunction/comments
Phyin_T30-4PITG_14583Putative uncharacterized protein
Phyin_T30-4PITG_14584Microtubule-associated protein EB1

Sequence
3266 bases(100 bases per row)
CTGCCAGTGTCACGCTGACACCTCTGAGTTGATTACATGACATCCACCCAGTGCCTCGACGACTGCTTTCCTGCTCGACCAAGGCCCCAGCTCTCCAGTT
ACAGTGCCATTTTACCATTTCGCATTTGACCACCTCAAGCAACAACCCCCACTCCACTCCGATCCAGTAGCCTCGTGTCATGATTCGACGCGTCAAGTTG
GCACTTGCGTGCTCAGCATTCGCTAGTGCAGTCGTCGTCAACGCTGAACTAGAAGACGTTCCAAGTTTCTCTGTTCCGTCGTTCGACTACACTTCCTTGC
AAACGGAGGATACACCGAACCGCATGCTCCAAGCTTTAGAGCGTGGAGGCATCATTGCACTCAAGAATATCCCCAACTACGGCAACGTCCGCGAACGGTT
CTTAACCAGTGCAGTGCAATGCGCCGTGGCGTCGGAAAACACCGACGAAGGTGTGCGTTATTTGTCGACCAAGCAGTTCCACGATGGCACTCGTCGCCTC
ACCTTGCGAGCTGCTGCTGGACGTGAACTCATGGAGACAGACACGGAGACGCTCAGTGCGATGGCAGCCAATTGTCCAGGCCACCGCGAACTCTCCGAAG
AGTTCAGCGGTATTTTAGAGCGAGCAGTGGACACGTTCGCTTCAGTTCTCGATCAGACCGGGTTCAAAATGGGCGACGGTGAACGCCACATCAGTGCACG
GAAACTTATTGGCGACGCTAAGCGTCTCGACCATTTCCACGCCTACGAAGCTGCAGCTTCGCCACCAGCCTCTACGCGTCGGTCTCTTTCAGCTCAAGAA
ATAGAGCAAGACTTGTCCTTAGCTATGCATGAAGACCACGGACTCTTTATCGCTATGTCTGCCCCAAAGTTCTTCTCGGTTCACAACGGGAATACCCGTG
AACGTCGTCTCAAGTCCGACGCCTCTGGTTTGGTCATCGGAGCAGCCGAACTGGACGAGATTGTACGTCCACACTTGAAGGACGATGAACTGGTGATCAT
GATGGGTACAGGAGCGTCCCGTTGGCTGGAAACCAGTCACCACCTCCCTGCTGTCATGCACGGCATGAGGATGCCTAAAGAAATGGTTTGGGACGACGAC
GCGACGCCAGGACAACGGAATCTCCGCGCCTGGTTTGGGAAAATGACCTTGTTGCCTTCGTATCAACGTTTACTCGAGAGTAAAATGGACTTTGACGAGT
TCACTAACCGAACTACTCGCCACTTGCTGGCGAATGGCGCCTCAAACGACGACCTCAAGGTGATTGGCTGCGCTGGTGGACGTCATTTAGTCGAGTCGGA
AGGAAGCTGCACGTACTCGATTTGCACCCTACGGCCTGGTGTGGAGAAACCTCCGACTGTGGGCTGTCACCAAGCCTGCAACTATCACACCGAGTTCTTT
GACGCCAAATGCGAGAAGAAATGTGACTGTTCTGGCACCACGACTCAAGCTGATGTGTGCTGGATGCTGTGTGTTGCACGACTGCCTGTTGACGAGTGTC
CCCTGGAATACCAGGAATGCTCCGGGCTCAAGATGATCTGCGATCCCAACGGCACAGTGGACAACAACGCGGCATCGCATGGACATGCCCCTGTACCCAC
CACAGTGCCCGCCGTTGAGACTCCACAACCGACGTTAGTGACGGAAGCCTCCACGTCAACTGAGACTCCACAGCCGAGCAATGTCCCCTCCTATACTGAG
ACGTCGGTGCCAACTACGGCAGCTCCGGAGCCCTCAACTCCGCTGCCAACCGAGACGCCAACCATTACGGAGCCGTCGACGCCTTTGCCGACTAATGCTC
CGATAACGCCGCAGCCAGCGATCACCCCCACATCAACTGAGGCGCCAACTGAGACTTCTGTCCCTTCGACCACTCCTCCGATTGCAACACTGGCCCCCGC
TCAGCCGACAGCCACGCCGTTGCCTGAACCGACTACCGCTTTGCCAACTGAAGCACCGACGACAGAGATGCCGAGCACTCAAGATCAGCAGACAGAAGAG
CCTGTGCTGCCCGGTGGACACTGCTAAACTGCCCTTCTCTAGTTTATCGAGGACTGTTCTTAAAACCCTATAAAGAAGCAGAAAACCAAGAGAACAAAGC
CCTTCTGCAGCACGTAGTACTTGGAGTAGTATTCATTGCCGATCTCTCCTTCCTCTTTTTAGTTTCCCGGTTAAAGTGACTTCCATTATCGAGCAGGTCT
ACGTCGACTTCTCGTCTACATCTGCTCGTCCTGTGGCTCGCCAGCCACTTGCTCGTCTTCAGCTCCTTCCTCCGTGGCGTACAGCACCTTGAAGATCGCC
TGGGCCAGCGGGTTCGACTCGTTATCTTCTGCCGCCTGCAGCATGATCTCCACTTCACGCAGCTTGTTGAAGTAGAAGTCGCGCTCCTTCTCCAGACTTT
CCACCATGGCACGTAGCTCGCCGCTCTCGTTCGTCAGCGCCTCGTTGTTGGCCGTGAGCTCCTCCAGTTCCTTCTCCAACGGCGCCGTGGCCGCTGCAAC
AGCCGCCTCCGTGTCTGCTTCAGACGGCGCAGCAGCAGCAGCAGACGCAGACGCAGCGCTTCCTACGGGACGACGCGTGGCCCCCGTCGACGTTCTGGCT
GTGCGAGCAGCACCTGCACTCGTCGGAGCTCCAGGAGGCGTCCGTCCGACTCTGGAGGTCGCAGTAGCGCCAACTTTTCGACGTAGCGGCGCTGCTGGTG
TGGACGACGAGGCGCCTCCACCGAACTTCTGCGTGTATTGCGCACCCCCTTTTCCTTTTTCACGCTGCGCTATGGGATCGTAGGGCTGGCCGGAGGCGTT
GCGCTCGTAGAAGGCCTTGAACCACTGCATAAACTCGAGATTGTCCTGATATTTGCCACGTACGAGTCGATCCACCTCGACGTGCTTGTCGATCTTAAGT
TGCATAAAGGCTTTCTGCAGTACTTTGTAGTTCTGAATGTACTCGTAGTCCTTGTTGGCTGCCCAGTCCACTTTGCTCATCTGTACTTTGCCCGGATACA
TGGCGTCCAGGATCTGGCAGGCCACAGCGCCCGTGCACGTCTGCTCCACCTTGGACAAGTTGATGGCGCACAAGCTATTGATCCAGTCCAAGATCTCCTT
ACGACCCACAAAGTATGTGCCGTCCATGAGGCTCATGCTCTGGTCCGCCATCGTCTCGACTTGCTAGAGGAAGTGTCCTTGCTTGGTAGGTTTTTGGCTC
GCGATTGCTGAAGTGGCGGCGGGTTGGGCGTTTTTAGCGTCAGATGGGGTATAGCCGGATAATGCA