Description :
From Genome Similarity Track
Location :
scaffold_74:33118- 40210
Transcript NameFunction/comments
g2818.t1hypothetical protein
g2819.t1 hypothetical protein PHYSODRAFT_327098

Sequence
7092 bases(100 bases per row)
CGTTTGTAGGCGACTTTGGCATGAATATGAACGGCGGAGACAACCGCTTCATGAACCAGTTCAATTTAGGCGGAAATGGCGTCAATAACGGCATGGATTT
GTCCGGCGGTCTGGACTTCAGTAGCGGGATGAACCTTATGACAGACTCGTCCATGCTGCTGGGCAGTAACTCGTCCACATCCACAGCAGGGCTCATCGAC
TTTCCAGACGAGCTTAACTCGCCCAAGACTACAAGCAGCGGCCCCAGCAGCAGCAGCATGATGATGGATACGTCGTCGGCCTCGGCGCCCATGACGTCCA
CGGCGGACGCGATCCCGTTCCCAGCATCGCTGGCCTCCGAGTCGCTTACGAGTAGCGGTACGTCTTCCTCGTCGTCTGGGGGACTGGACGTGATGAACTT
TATGAACACGACCACGACCAGTAGCGCCATGGGCAACAATGCCAATGGAATGGGCCTCGACATGAACATGGGGCTGAATATGGGCATGAATATGGGGATG
AGCATGGGCATGAACAACAACATGGGCATGGATATGAGTGGCATGAACTTCGGCATGAACGACGGTAACAATATGATGTTCAACAACATGCAGCACATGA
ACATGATGAACTCGCAACAAAACTACTACATGCCCCAGCAGCAGATGCAGCAGCAGCAGCAGCAGCAGCACTACATGCAGATGATGCAACAACAGCGTCT
AAATATGCAGCGTCAGCAGCAGCAAAAAGCGATGCTCGAGCGCCAGCGACTGGCCCAGCAGCAGCAAGCCCAGAAGAACAACGCTAATCAGCAGAGTCTT
CAACAGCAGCAGCAGGCTGCGCAGCAGAAGCAGCAGCAAATGCTCGCGGCAGGTCAGGTTCCATCTGCTCAGAGGCAGTTGAGTGGAGGAAACCCAGGTG
TGAATGCTGCACGCTCTCAGCCTCAAGCTTCGACTCCAAATACTGGAACAGCTACGACTTCAGCTCGACCAACGTGGCAGTCTCCAGCGGATCAGGCGCT
GCGCAAGGAAATGCTGAATCATATTATGCGGGTGCTTCAGAACCAGCGGTCAAATGCACCAGCAAATTGGCTGCAGAAGCTGCCGGAGATGGCGCATCGA
CTTGAGGACGAGTGCTACCGCATTGCTACCTCGCGTGAAGAGTATGCTAATACGAGTACGCTCCAGTCTCGTTTACGTAGTATCGTGCGTAGTGCCCAGA
CTCACCAGCGCAATATTGGAGCGAACGCCATGAGACAGCCCGGTGCACCGAACCAAGCCCCTGCGAATGCAACCTCGTCGACTTCTACGTCAGCAGCGAC
GCCCATCCCATTCCCCGGCGCTCAAGCAGTTGCTCCAACGTCGAGCGGAGTTTCCTCAGAGGTGAAAAGCCTTGCTGCACATGCTATTCAGATGCCACCA
GAACTTCAGGATCCTCCGTCCCAAGTGAATACTCCAGTCAAGGTAGAATCGTCCCAAACTCAAGTACCCTTGACGATGGATTCCGCTATGACGGATCGTT
CGTCTTTGAGTGGCACGGGTATCTCGCCTCTTGCTGTGCAGAATGGGGTGCAAACGACGCCAGGGCCTGCTGGTTCTAATGCAACCGGATACTCAACCGG
TTCTGCAGCCAACTCGCCTGCTTCAGCTGCTCGTAACAAATCGGCCCAGATCATTTGGCAGTTTAAAGCTAAGGCCCAACAAGTTACTTCGGCTTTGGAT
AAGAACCAGACAGCGGAATACCACAACAAGCTGCGGCTCATGGTTCGTGATGATGTAAAAACCGCTGGATCGAAGGAAGTATTACAGCGTCAGCAACAGC
GATTGTTGCTGCTTCGTCACGCGATGTGGTGTAAATCGGCTGAGGGCAAGTGTACGACTACGCCAAGCTGTGGTGAGATGAAGCGGCTCTGGGCCCACAT
GGGTGCATGCCAGCAGACGAATGCGTGCTCCTACAGCCACTGTATTTCTTCCAAGTACGTGCTTTCGCACTTTCAGCAGTGCGTAAACCCCAAGTGTCTC
GTATGTCAGGTGGTTCGGTATCCTGTCGAAGTGAAGGAGAAAAATGGAGCGTTGATGCTCGATGCAGACCGTGCATTGCAGCAGATTATTGCAGCGAGTC
AGCGTCGACAACGCATGCTTGCGATGAAGAAGCAGCAGGAGATGCAGCAGCAACAAATGCAGCAGTCTCAACAACCGCAACAGTCCGTGCCATTGGCAAT
GCCTGCGCACCTGCAGCAACCTCAAACAAATGCACCAATGAACTTCCAGCAGCAGCAGCAGCAAAACGCCGGGCAGACCATGAATCATGGCACTCCGGTA
GGTGCAAACATGACCTCCATGGGAATGGCGGTGCCGAACGGAGGCAACCGCCCTGCCTCAATGACACCCAACGCAGCTCCTGTTGCAGCCAATGACATGA
TGCGTCAGCAGTTTCCTGTCAAAGCGGAAAGCACCGTGCAGCCGACGAACCTTGTCCCTGATGATCAACGACAACTCCAGCTGATCAAGCAGAAACTAAG
TGGGCGTTCTCTGGAACAGCTAACGGCGCATTGCGTAAAACTGGAGAAATGGGTGGAGGAAATTCGTGCGCGTATGAACTCTATTATGAACGAGTGCCGA
CAGCTACTGCACCTGTCGAACTCGACGCAAGATCCGATACAGAAAACCCAGTACGAATCCCAGGTCCAAGAGAAACGTGTTATTCTTAAGCAACTGGATG
TGAAGTTCAAGCAGTGCAGAAGCCAGCGGAATATTGTGAAGCACGTGATTGATGAGCGCAATGCTACCGCGTCACTCTCAACCCCAAATGGCATGAGTTC
AACCCCGAGTGCAATGCAGGCAATTCCAATGCCCGCTCAGATGCAGCAGCAAACTTCTTTCAGTCAGCCGCAGGCATCACCCGCTAATGCTTCTGTGACA
CCAAAGCCATCACCAGATGACCTACTGACCGAGGAAGATGATGTTCCTTCGAAAGTTGATGGGGGTGCTGCAGTCTCGGGAAAGCCTCTGGAAATGCCCA
TGGACCTACAAGATACAACTGCGACTCCTGTTTCTGTAGCTGCACCATTGAACATGTTAACAGCACCACAGCAACCGACTGGAAACCAGGCTATGACGGC
TATGAATGGGCCCCGCCCAGGGTTACCGATGAACCACGCCCAAGGTCATGGATATGGGCATCATCAGGGTCAAATGCAAGAGAATGGGAAGATGGTTATC
CTGTCAACAACTCCAGGGGCACTGGGTGTGACGGTAAAAGAAGAACCTCATGTGAAATTGGAAACTTCAGGAGCGACTTCTACTGTCAAAGAGGAAGTGG
CCATCAACCCGCTGACGATGAACAATTCCAAGTTGAATGCTATGATGTCGGAGCACCGCCGAATGGATGCCAGTACAAGCTTGCAGCTGCCTGCTGGTGC
AGTAGGCACACCAAAAGCGATTATTACGGCTAACGGGGGGAATGCAACGTCCAGCGTTGCAGGCGCAGCAACACCAGCACCGCCAGCTTCCTCGGAAGTT
CCGATGTCTGTGCTGAACGAACTGAGTAATGAGGATCTGGCTTCTCATGTGGAGTCGCTAGTGACGGACTACAACGCGACGGTGTCCCCAACGAATCTGA
AGAAGAAATTGGAAGTGATTTTGAAGGGGATGATGGATCACAAGTTTGGATGGGTGTTTAACTCGCCTGTGGATACTGTTGCGTTGAACATCCCGAACTA
CTTTAAGATTATCCGGAAGCCGATGGACCTGGGGACTGTCAAAAAGAAACTTGAGGTAGGTATCTACAAGCACATGGATGAATTTGCCTTCGATGTGCGT
ACTACGTTCCAGAACGCGATGCAGTACAACAGCGAAGACGAAGACGTGTACAGCCTTGCGAAGGACATGCTGTCGGATTTTAACAGCGAAATGCGCAAGG
TTGGAGCTGAAATTGAGGTCGATGAAAAGGCTGCGCGTGCAAAGGAGAGCTCTTGCCGTCTTTGTGGTGTCGAGCGCATGGTGTTTGAACCTGCTGTCTT
GTACTGCAACGGCGAGTGTAACAGCCGTATCCGACGGAATTGCTACTATTACACTTCAGCAGATAACAAATATCACTGCTGCCACCAGTGCCACGCTAGT
CTTCCGGATACCATCAAGCACAATGAAGGCCGCCAGTACCAGAAGAATGAACTGTCGCGAAAAAAGAATGACGAAGTGCACGAGGAGCCCTGGGTGCAGT
GCGACAAGTGCGAGCGTTGGGTTCACCAGATTTGTGCTCTTTTCAACGGGAAGATCGACAGCGAGAAGAAGCCGCAGCTCGTCAAAACGGAGGGGGGTCA
ATCGACGGATAGTGGTGATGCATCTTCGTCACCTTCAGCGTCCTCCAAGTCTACCACGGTCACTACTACGGTGGTTAAAAGTTCTTCGGCATCAGGGTCG
AAGGGGACGGTGCACTCAATCACGACATCCCCAGGCAGCGAGTTCCTGTGTCCAGAATGCTTACTGGAACATCGCAAGAGTGAGCCGCAAAAGTATAAGA
TCGGGCGTCACGCTTTTAGTGCAAAGGACCTGCAGCGCACGAAGCTATCAGATTTTCTGGAGCGTCGTATTACCAAAGCACTGCAAGCAGAGCGTGAGGA
CGAGGCGAAATGGACGCAACGTGACGTGAAAGATGTTGAGACTGCGGATGGTCTCACAGTGCGTTTGGTCTCGAACATTGAAAAGCAGCTGATGGTGCGC
GATAGAATGTTCCAGCGGTATAAGGACTCGCACAAGTATACTTCGGAGCATCGCTTCAAGTCCAAGTGTATCTGTATGTTCCAAGAGATTGACGGCGTGT
CGGTGTTACTCTTTGGTATGTACGTGCACGAATTCGACGAGCAGGAGGCGGATTGTAACTCGCGCCGCGTGTATATCTCGTATCTGGACTCGGTGAACTA
CTTCAAACCACCTCACCTTCGTACGAAGGTGTATCACGAGCTGCTGATCGCGTACTTCGACTTTGTCAAGCAACGCGGCTTCCACACAGCGCATCTATGG
GCATGTCCGCCTTTGAAGGGCGATGATTATATCCTGTACTGCCATCCAGAGGCGCAAAAGACGCCCAAGTCGGACCGCTTGCGCGCTTGGTATGTGGACA
TGCTGGTCAAGGCAGAAAAGGAAGGCGTGGTGTGGCAGATCACCAACATGTACGATGATTACTGGCGCAATGACAACACGCCGTGCGCACTGCCGTACTG
CGAAGGCGACTACTGGGTCGGCCTGGCCGAAGACTTAATCGAGAAGTTGGACGCCGAGAAGCCGAAAAAAATCGTCAACAAGCGTGGTTCGAAGTCGCAC
AAGCGTAAGAACTCGGACACGAAGAAGGCAGCGAACAAGAAATCAAAGTCCAAGAAGCCGAAGCGCCGAAAGACCGCCGCTGGTGGAGAGGCGTCTGGTG
ATGAGGATGAAGACGACGATGCACACGAAGTCACTCCGTCGGCAAGCAACCGCACACTGACGGTGAAGTCGTTGGATAACCCTGACAGGAAGCTTTCGGA
CCCTTTGATGCACAAGCTTGGCGAGGTGATCGAACCTATGAAGGATGACTTCTTGGTGGTAAAGTTGGTGCCTTGCTGTCGTGTGTGCAACACGTCGGTG
GTGCAGGGCGATTTGTGGCTCGACCACAGTGTGAAAACGGAGGGTGGTCTCAACCCGAAGGTAGTACAGACGGCGCTTTGTGATGGATGCTACCAGAAGT
TGAAGGTCGTATCGGTCGCAGGTTCCTCCGCAGCCCACCACCGACTGCAGACGCGGTTGAACGCTCTTACTCAGGAGATGGTTGCTTTGCCCGAGCGCTG
CACGGACCCCGACGAGATCAACGACAGCGAGTTTTTCGATACCCGCCAGGCCTTTTTAAGTCTCTGCCAGGGCAATCACTACCAGTTCGACGAGTTGCGG
CGCGCGAAGCACTCGTCCATGATGGCCTTGTACCACTTGGGCAATCCGAACCCCAACGCCTACGTGTACGAGTGCAACGCGTGCACACGCGACATCGTGA
CGGGTAACCGCTGGCATTGCCACACGTGTCCAGACTTCGATGTGTGCGACGCCTGTTATGCGAAGGAGAAGCATGAACACCCACTGGAGATGGTGCCGAC
TAGCGGTGGAGGCGTTGCCGGGGCTGGTGCAGGTCCTGCAGGGCCTGGAGGCGCGGCAGGTACGGCCGCACTGTCGGCCGAGCAGCGGCGTCTTCGCGAA
CAGCGGGCCAAGAACGTTCGGTTGCACATGCAGTTGCTGGTTCACTCGAGCTCGTGTGCTGACGGCAACTGCGGTTCGTCGAACTGTGAGAAGATGAAGG
AGCTAATGCGCCACGGAGCGCAGTGCAAGCAGCGTGCGTACGGTGGCTGTACGATCTGTCGGCGCGTGTGGGCGCTTCTGCAGCTCCACGCCCGACAGTG
CCGCCAATACGAGTGCAAGGTGCCGCGCTGCCACGACCTGCGCGAGCACGTCCGCAAGTTGCAGCTGCAGCAGCAGCTCATGGACGACCGTCGTCGTGCT
GCCGTGACCCAGCAGTACCGTCAAATGCAGAGCGAGCGCCAGCAGGAGCAGCAGAACCAAGCTCAAGGCGACGACCCCATGCCTCAGGCATGACCGACAG
CACTAGATCGAGCGGTTGAGGAACCAAAATGTCGAGTGTAGCATAGGATAGGGTAAACCATACTAATTGTAGATGTGTGTCAACGTGGCTGAAGTCTGCA
AAAACAAATGAACGACGTGGATCAAGCCCGCGCATACTATAAACTGCTCAAGAGGGGGAGTCTTTCTAACGTGAGATACAGACAGCGGCAGGTCGATCGC
GGCTCCTTCTCTCTATGCCTTCTTGGCTCCGAGCCGTTTCTGACGGCGACGGTGGTGCGAGCACGGACGCTTGCCGTGGTTGGCCTGTAACCATATAACA
AACATGAGTACAGCAAATTCCAACAATGAATTTGTATCTATCTCGACCTTCTTCGGACGACGAGCGTTGCGGTTCAGCAGCTCCATGGCAATAGGCGTCT
CGAACAAGTTGGTCGACGGCACGCTGCGCACGTTAGCGACGGCCAGGGCGGACGGACGCGCTGCAAGGAGGAATGACACACAGCGATTCGGA