Description :
From Genome Similarity Track
Location :
Scaffold_42:33118- 34138
Sequence
1020 bases(100 bases per row)
CGACATCTGTAACAGAGCACTGCCTATGGAAAAGTCAGATGCGTCACAGACGACACTGAAAGGTCTATCAGGATCGGGCAAAGCCAGTATTGGCGCATGA
AGGAGACTACATTTAACTGCTTGAAAAGCCTCATGTTCGGTGTCACCCCAACACCAATCCACATCCTTTTTGAGGAGATTGGATAATGGCCGAGCCATAC
CTGCATAATTCTCACTATACTTATGCAAGTAATTGGCAAGGCCAAGCCACTTACGTAGATCTTTTTGGTTCTTTGGAACCGGCCAATCGACTATGACCCT
TACCTTAGCGGGGTCCGCTCGAAGGCCTCGCTTCCCAATGAAGCACCCCTGAAAGGTAATCTCTTCTGCACCAAAGATGCACTTAGATTCATTTGCATAC
AATTTATTCGTGCGCATGCACTCGAGCACCGCTCGTAAATGATCAATGTGATTATCCACATCAGATCGACCGTTCGTTGCACGACTATGGACAAAGACGT
CATCAAAGTACGTTTGTGCATAGCCTCGGTGAGATCTGAATAGTTGCGCTACCAGACGATTAAAAGTAGCCAGGGTATTTGACAGCCCTTGTGGCATAAC
GAGCTATTCCCAGAGCATACCGCTCGGGGTACTAACCGCTGTTAGCGGAATATCGCTTGCTCGCATGAGCAGCTGGTAATAACCATCGACTAAATCGAGC
GCACTGTACAATGTACATCCCACCATATTGTTCTGAAGAACATCCTTTCTGGGGATTGGAGTCTGAGCCAGGATAGTGGCAGCATTAAGCTTATTATAAG
CGTTCACAATGCGCCACATACCATTAGGCTTTTTGACACAAAATGTAGGTGTGAAATGGGGAGACTTACTCTCCCGCACCATTCCCGCCGCGTGCTTAGC
ACGAAAGAAATCGTCAATGATGTCACACTGTTTTTTAGGTAAAGGCCACTGCCGTGTTACGCAGTATTTAGCTCCTGGAACTAGGTCAATTTCATGACGT
ACACCTCTATCGGGAGGTAA