Description :
From Genome Similarity Track
Location :
contig_30:33111- 34439
Transcript NameFunction/comments
g6502.t1hypothetical protein

Sequence
1328 bases(100 bases per row)
GTGAAGGTCCTGGTGGTGGACCACAGCAGTCCCCTTGAATGTGCGATTGCTCACTCGGAACTTGAAGTCTCCCTTGTTGTCAATTGCGCCACTGACCGAA
AGACGCACTACTGGGTTGTCTTCACTGTTCAGCGCCACCTCGTACATGTTTTTAGACAAACACTTGACAGACACCGAAGACCTTTCATCGCCATGGTTCA
GTTGAAGCCTTCTTTCGAGTGTGTCCAATGAGCGGAAATGCGCTAGCGAGTCATCGGTCCACGGGGAGTGTAGCTCGTACTCTGATTTCCACCAGAGTGG
CGCTGGATTTGCTCAAGAAGAAGCAAACTCACAGCCCCCATCGCTGTAGCATAAGTTGGGTATGACCCCAAAGGTCCGAGCACGTCGTCACCAAACTTAT
TCAGGAAGCTCGTGTCAACACCGCCTTTTCGGAACGCAGCATGATCCGCAGTGCGGGCTACGAATTCGATATTCGTCGGGAGGCCCACGATTTGGTACTG
GTGAAGCGCCCTAACCATCTTGTCCAGTGCATCCTGACGACTATCACCGTGCGCGATCAGCTTGGCGATCATTGGGTCGTAGAAGATTGAAACTTCGTCT
CCTTCAATGATACCTGTGTCCACACGAACGTCTTTCGATACAGGAGGCAAGCGAAGATGTTGCAAAGTACCACTCCCGGGAAGGAAATCACTGTTGGAGC
ACAAAGCTCGTGCCAGTAAGTCTACGCATTTTGCAACAACAAAAAGCGAATAAGCTCGAAACGTACTTGTATGGGTTTTCGGCGTAGATCCGTGCCTCAA
CAGCGTGGCCATGAATTTTTAGGTCCTCTTGGCGTATCGGAAGCTCTTGACCTGCGGCAACCATGAGCTGCAGCTCAACCAAATCTTGCTGCGTGATCAT
TTCGGTGACGGGGTGCTCCACTTGGAGACGCGTGTTCATCTCCATGAAGTAGAATGACTCGTCCTCGTCCAGAAGAAACTCGACAGTTCCGGCGCCAACG
TAGCCCACAGCCTTCGCTGCAGCAACGGCAGCATCTCCCATTTTCTTGCGCAACGCTTTTGACATATTGGGCTATTACAAACACACATCGCATCGTGTAA
GTGAACAAGACAAAAGCTATGCATACACGGCAGAGCCCCACTTACAGCTGGTGCCTCTTCCAACACTTTCTGATGACGTCGTTGCACGCTGCAGTCGCGT
TCAAACAGGTGAATGACGTTTCCATGTTTGTCTCCGAAGATCTGGAGCTCCACATGCCGCGGCTTCGTTAGATACTTCTCGATCAGCACTCGTCCGTCTC
CGAAGGACGCCTGTCCCTCCCTCACACA