Description :
From Genome Similarity Track
Location :
contig_30:33111- 34439
Transcript NameFunction/comments
g6205.t1RAW31106.1 Methylcrotonoyl-CoA carboxylase subunit alpha [Phytophthora cactorum

Sequence
1328 bases(100 bases per row)
AGGTGAAGGTCCTGGTGGTGGACCACAGCAGTCCCCTTGAATGTGCGATTGCTCACTCGGAACTTGAAGTCTCCCTTGTTGTCAATTGCGCCACTGACCG
AAAGACGCACTACTGGGTTGTCTTCACTGCTCAGCGCCACCTCGTACATGTTTTTAGACAAACACTTGACAGACACCGAAGAACTTTCATCGCCATGGTT
CAGTTGAAGCCTTCTTTCGAGTGTGTCCAATGAGCGGAAATGCGCTAGCGAGTCATCGGTCCATGGGGAGTGTAGCTCGTACTCTGATTTCCACCAGAGT
GGCGCTGGATTTGCTCAAGAAGAAGCAAACTCACAGCCCCCATCGCTGTAGCATAAGTTGGGTATGACCCCAAAGGTCCGAGCACGTCGTCACCAAACTT
ATTCAGGAAGCTCGTGTCAACACCGCCTTTTCGGAACGCAGCATGATCCGCAGTGCGGGCTACGAACTCGATATTCGTCGGGAGGCCCACGATTTGGTAC
TGGTGAAGCGCCCTAACCATCTTGTCCAGTGCATCCTGACGACTATCACCGTGCGCGATCAGCTTGGCGATCATTGGGTCGTAGAAGATTGAAACTTCAT
CTCCTTCAATGATACCTGTGTCCACACGAACGTCTTTCGATACAGGAGGCAAGCGAAGATGTTGCAAAGTACCACTCCCGGGAAGGAAATCACTGTTGGA
GCACAAAGCTCGTGCCAGTAAGTCTACGCATTTTGCAACAACAAAAAGCGAATAAGCTCGAAACGTACTTGTATGGGTTTTCGGCGTAGATCCGTGCCTC
AACAGCGTGGCCATGAATTTTCAGGTCCTCTTGGCGTATCGGAAGCTCTTGACCTGCGGCAACCATGAGCTGCAGCTCAACCAAATCTTGCTGCGTGATC
ATTTCGGTGACGGGGTGCTCCACTTGGAGACGCGTGTTCATCTCCATGAAGTAGAATGACTCGTCCTCGTCCAGAAGAAACTCGACAGTTCCGGCGCCAA
CGTAGCCCACAGCCTTCGCTGCAGCAACGGCAGCATCTCCCATTTTCTTGCGCAACGCTTTTGACATATTGGGCTATTACAAACACACATCGCATCGTGT
AAGTGAACAAGACAAAAGCTATGCATACACGGCAGAGCCCCACTTACAGCTGGTGCCTCTTCCAACACTTTCTGATGACGTCGTTGCACGCTGCAGTCGC
GTTCAAACAGGTGAATGACGTTTCCATGTTTGTCTCCGAAGATCTGGAGCTCCACATGCCGCGGCTTCGTTAGATACTTCTCGATCAGCACTCGTCCGTC
TCCGAAGGACGCCTGTCCCTCCCTCACA