Description :
From Genome Similarity Track
Location :
Scaffold_1678:3311- 4954
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1678-fgenesh-gene-0.0Amino Acid-Polyamine-Organocation (APC) Family

Sequence
1643 bases(100 bases per row)
TCGCTCTTCACGGGCATGTGGCGCACCAAGCCGATGCAGGTCATCCAGGCCGAGGAGAAGGCGGAGGACATCCCGCGCACGCTCACACTCTTCGATCTTA
TCTGCATCGGCATCGGCGGCACGATCGGTAGCGGTATCTTCTCCACCGCCGGCTCGATCATCAGCTCCACGGCTGGCCCCGCCGCGGTGATCAGTTGGCT
CATCGGCGGTGTCATCTGTTGCTTCAACGCGCTCGCGTACATGGAGCTCAGCACGCGCATCCCGTCCTCCGGCAGCACGTACGCCTACGCGTACCACACG
ATCGGCGAGCTGCCTGCGGTCATCGCAGCGTGGCTGCTCACGCTCGAATACGCTGTGTCCGGCGCTGGTGTCGCGCGCAGTTGGGGCGACAAGGTTGAAG
ATTGGCTGATCCTCGACTACCCGGACAAGGACTTCCACTGGCTCAACCTCAAGTACGCCAACATCCTCGGCGCCTTCGTGCAGTTCATGAGCATGGTTGT
GCTACTCATGGGCGTGCGCTTCGGCAAGGCGTTCGTGAACACGGTCACGATGATCAAGGTGGCCGTCGTGCTCTTCATCATTGTCGTGGGTTTTGCCGCC
ATGGACGTGGACAACTTCTCACCGTTCGTACCAAAGGAGACGGAGACCGACGGCGTCACCGCATTCGGCTTCCAGGGCATCATCACCGGTGCGTCGCAGG
CGTTCTTTGGCTACGTCGGCTTCGACGAAGTGTGCTGTCTCGCCGGTGAGACCAAGAACCCGAAGAAGGTCATGCCGATCGCGGTCATGAGCGTCGTCAT
CGGCACGACGGTGCTCAGCACGCTCTGCTCGCTCGTACTCTCCGGTATGGTGCCGTACTTGGATGCGTCGAGCTTCCCAGCAGGTTTTGAGGGTCACGGA
TGGAAGTGGGCCGGTGTGATCGTGCGCGCCGGCGAGACCTGCACGATGCCTGTGGTCGCGCTCATCGGCTTCCTCGCGCAGCCACGTCTGAATTACGCCG
TCGCGTGCGACGGACTCATGCCGCAAATCTTCACCAAGGTGGACGACTCGGGCAACCTCTGGTGGAACACGCTCATCACAGGTTTGTTCTTCACGGTCGT
GGCGTTCGTCGTGCCATTCATCACGCTCTGGGACATCGTCACGTTTGGCGTTATGATGTCGTTCAACATCGCCAACATCGCGATACTGCTGGTGCGCATG
AAGGACTCGTCGCCGCAACTCGCGCCGTGCCTCATTGGTGCGCTCTTCGTCGTCACGGGCTTCACGGCATTCTTCTACCAGGAAGGCTACGTGAACCAGG
ACTCGGACGCGTGCCTCGTGCTCGCGATCATCTTCCTGGTGCTCACCGCCATCGTGACGGTCGTGCTCGCGGTCAAGTGCGCGCAGTCGCCGAATGACCC
GCAGTATTTTTCGTCGCCACTCGTGCCGTACATCCCGGCGGTGTGCATGCTCGCGAACTGGTACATGATTGCGCAGATCAACCACCTGGCGCTCGAGCTC
AGCGTCGCGTGGGTCGGCGCCGCGATCCTCTCGTACTTTGCCTACGGCTACTGGTACGCGGCCGGTCGCAATGGTTGGAGTGAGCTTCTGCGCTTCAACC
TACCGAGCCACAACGCCAGCCTCCAGGAGCCGATGCTCTCGGT