Description :
From Genome Similarity Track
Location :
scaffold_33:331073- 334866
Transcript NameFunction/comments
Plaha_PHALS_03059hypothetical protein

Sequence
3793 bases(100 bases per row)
ggtcggctaagggccgaggcatcgagggcgaggccctcgtgatgcgcttagagtggcacgttaaccactggacaaagactgcggggttggcagctcttcg
tcggatgttttggataacatcggagctcaaaggatcggaaagtgagggtgactcCAGACGACGCGAAATGCGTGTTCACTCTGGTcttaccgagacatag
aatctcTGcattacgcgcacgtctcttggtggagctttagcGAGTCATGAAGCCACCTCtactaggagacaaaagcgttattggcgagagcactggacca
agacggtcaacgtgctagacgtTGATAtttccgagttggtagacaccaatggTGTATtgaacaggagtcccgagcgtggctcgcgggctgatcgtggagt
ggtacgtaacccactgggTGATGCacaagttttggagcagttgctgcatgtaatgcgtgacatggtcgaccaagggccgagacatcgagggcgaTGCCTT
CGTGATGCATATGAAGTGGCACAAAaactactgagcgctgctcgagtatcaaagcagtcgctgcatgccaatgagggcgtggtcggacagagggCCGAgg
tatcttgggcacggcccttgaGATGCGCTTGGAGTGGCTCGTTGTCCACTGGACGGAGATTGCGGGTTAttagttcttcgtcggatgttgtagataacat
cggagctccaatggcgtggaaagtgagggtgacaccagatgcgtgttcaccctggtctcacggagacatagaacctctgaaCAGAGGGGACGGCGACGCC
gaatgctggctgcaagacgccaggcgtcgaccctgatccaggctgtgtctaccgtagacgacgttgcacagttatacaatctcgtcaacagtatgacggg
ggaggaagatggcgacgtccgcctcgaggctatgcctgtaGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCTACACCAACACCAGCTCCGACACTAACACCAGACTTCAATCCAAGACCAGCGCCTACTC
CGACCCCGCCTTTCAAGCCGAGATCAGTATTTACACCTAGACCGACACCTCCACCAAGACCAGCTTTCAAATCAAGGCCAGCGTCTACACCAAGACCAGT
TTTGACACCAAGACCAGTTTTGACACCAAGACCAGTACTGACACCAAGACCGGCTTTCACGCCGAGACCAGCATCAACGCCACCACTGAGTTTAACACCA
ACATCCGCACCTACATTTACATCAGTTTTCACACCAAGTCCGGCGCCCCCAGCAAGACCAGCTTTGACATTAAGATCAGCTTTGACACCAAGACCAGTAG
TAACACCGAGCCCGGCATCTGCACCAACACCAGCGCTTACACCACCTCCAGCTTTCACAACTAGACCTGCGCCTGCTCCTCCATCAACTTTCACTCCGTT
GTATATCATTTCACAATCGTTCGCATTCGCACCAGCAGTATGAATAGTGAAGCCGGAAAGCGCGACAGCTACTGCCAACATTCTAACGTAATAGTTGCAA
GAAAGCATGGTACGAATGGGACTGGAAGAAGGAGTCAGAAGGACTAGAAAGGACTCGGATGATTGAgtgcaaattttaaaatgaaGTCGTAGATGTTAAG
CCAATGCAACATTCCAAAGATTTTTGATCCATGTGCTTTGAGCGGTACAGGAATAAGTCCTGTATCGAAAAAGACACATAAGATTTTAAACCTGATCTTA
TCCAAATTTGAATTGATTTGTTATTGTTGTATTGGTTACTGTGAAGAAGAACGTAGCATTTTCTGTTCGTATTCATTACTCTTTTGGAAAAGCTCCAACC
TCTTATTACTTGCATGGGTGCCACATTGACACGATTCGCTCGACTCTATATGCTAAATATCATTTCACCAATCCCTTATCACAGGAAATGCATCCAAAGC
TTGTAGCTCCTGAAGGTCTATGGTTGCGACTTTCAAACATGTGGGTTTATGATTGTGGCCCAAAGTGATCAGAGCCAGCATATGCCAATTCATACAATAT
TTGAGTACTGTGTGGTAATAAATGGCCTTGGACCAGATATCTAGATGACCCTCACCGAGACTATAATAGCTGCAACTTCTCTCAATAGTGTGGTTCTCGA
GGAAAGTAGAGCCAAAGAAGGTCCCTCGTGCATATTAGGCTTAAATTCTTATATCTCACATAAAAACTTTGCTTAGCTTTACTAACGTCGTATTCATGTG
TGTAAGCGGTAGCAAATTACAAAGCTGACAATAGCAGTCAATTTTGAGAAAGTCAACAGCTATCTCGGACAAATGGAATATAATCATTGAACCCGCTGCG
TATATGTGGACGGTGAAGCCGAAAAACGCCGATAATAAATGTTGCTCGTATTTTGTAAGTTCTTTTCTGTCTGTAGCCAAATACTGGCCTGTCAAAAATC
TCACCGCAAGTTCTATCAATACAAGCAATCAATTTCGGCGACATATAACTCGTGACGCCTTACCAAGATTCAGGCTCAGTTTACTACTTCAAAAAGTTTA
TTGTCTGTCACCTTGTCGTGCGCTATTTCTAAGTTGACAACTTCATGTTCAACGCTTCGTTCAGTCGATAAATGTTGTAACGAAACTTATCAACGTATTT
TTATTCTTCGTTGTCACCGACGGAGTTAGCAAATGTAATTCATAATTCAACGTTCTAGATATAGCTCTGCAGCATCATTTTGGCCGACGGTAGAACAACC
TAATGTCAATCGTTTTAGTGCAGCTGACCCTTCGTGAGAGTCTTTCGCCTTTCGTTTCAATCGGATAATCAAGGCGACGCAACAAGCTGCTATGTGCTAT
CATTCTCCTCAATTGTGTATTAATAACAGAATAGAGCCTTCGCTCAGATTTTCAAATTGCCAAACTTTCTGGGTCGCTTTACCTATTCCATAGCATGCAA
GCGACTACGGTCTGAGTTGTTTGATTGCATAGTAGAGCTCAAAAAAAAAGAACTGGACATGTGACCGTCAGACACAATTCTGAAACACAAAAAATGCTGC
TTTTTCAACGTATTTTCGCCTATGCCAATTCCATGCATCCAATCTTTAGACCTTGCACAAGCTCCAAACACAAATTTGGGTTTCAACTTTTCG