Description :
From Genome Similarity Track
Location :
scaffold_33:331073- 332351
Transcript NameFunction/comments
Plaha_PHALS_03059hypothetical protein

Sequence
1278 bases(100 bases per row)
ggtcggctaagggccgaggcatcgagggcgaggccctcgtgatgcgcttagagtggcacgttaaccactggacaaagactgcggggttggcagctcttcg
tcggatgttttggataacatcggagctcaaaggatcggaaagtgagggtgactcCAGACGACGCGAAATGCGTGTTCACTCTGGTcttaccgagacatag
aatctcTGcattacgcgcacgtctcttggtggagctttagcGAGTCATGAAGCCACCTCtactaggagacaaaagcgttattggcgagagcactggacca
agacggtcaacgtgctagacgtTGATAtttccgagttggtagacaccaatggTGTATtgaacaggagtcccgagcgtggctcgcgggctgatcgtggagt
ggtacgtaacccactgggTGATGCacaagttttggagcagttgctgcatgtaatgcgtgacatggtcgaccaagggccgagacatcgagggcgaTGCCTT
CGTGATGCATATGAAGTGGCACAAAaactactgagcgctgctcgagtatcaaagcagtcgctgcatgccaatgagggcgtggtcggacagagggCCGAgg
tatcttgggcacggcccttgaGATGCGCTTGGAGTGGCTCGTTGTCCACTGGACGGAGATTGCGGGTTAttagttcttcgtcggatgttgtagataacat
cggagctccaatggcgtggaaagtgagggtgacaccagatgcgtgttcaccctggtctcacggagacatagaacctctgaaCAGAGGGGACGGCGACGCC
gaatgctggctgcaagacgccaggcgtcgaccctgatccaggctgtgtctaccgtagacgacgttgcacagttatacaatctcgtcaacagtatgacggg
ggaggaagatggcgacgtccgcctcgaggctatgcctgtaGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN