Description :
From Genome Similarity Track
Location :
contig_30:33105- 34430
Transcript NameFunction/comments
g5264.t1L-aminoadipate-semialdehyde dehydrogenase large subunit, putative

Sequence
1325 bases(100 bases per row)
TGTCAATTGCGCCACTGACCGAAAGACGCACTACTGGGTTGTCTTCACTGTTCAGCGCCACCTCGTACATGTTTTTAGACAAACACTTGACAGACACCGA
AGACCTTTCATCGCCATGGTTCAGTTGAAGCCTTCTTTCGAGTGTGTCCAATGAGCGGAAATGCGCTAGCGAGTCATCGGTCCACGGGGAGTGTAGCTCG
TACTCTGATTTCCACCAGAGTGGCGCTGGATTTGCTCAAGAAGAAGCAAACTCACAGCCCCCATCGCTGTAGCATAAGTTGGGTATGACCCCAAAGGTCC
GAGCACGTCGTCACCAAACTTATTCAGGAAGCTCGTGTCAACACCGCCTTTTCGGAACGCAGCATGATCCGCAGTGCGGGCTACGAATTCGATATTCGTC
GGGAGGCCCACGATTTGGTACTGGTGAAGCGCCCTAACCATCTTGTCCAGTGCATCCTGACGACTATCACCGTGCGCGATCAGCTTGGCGATCATTGGGT
CGTAGAAGATTGAAACTTCGTCTCCTTCAATGATACCTGTGTCCACACGAACGTCTTTCGATACAGGAGGCAAGCGAAGATGTTGCAAAGTACCACTCCC
GGGAAGGAAATCACTGTTGGAGCACAAAGCTCGTGCCAGTAAGTCTACGCATTTTGCAACAACAAAAAGCGAATAAGCTCGAAACGTACTTGTATGGGTT
TTCGGCGTAGATCCGTGCCTCAACAGCGTGGCCATGAATTTTTAGGTCCTCTTGGCGTATCGGAAGCTCTTGACCTGCGGCAACCATGAGCTGCAGCTCA
ACCAAATCTTGCTGCGTGATCATTTCGGTGACGGGGTGCTCCACTTGGAGACGCGTGTTCATCTCCATGAAGTAGAATGACTCGTCCTCGTCCAGAAGAA
ACTCGACAGTTCCGGCGCCAACGTAGCCCACAGCCTTCGCTGCAGCAACGGCAGCATCTCCCATTTTCTTGCGCAACGCTTTTGACATATTGGGCTATTA
CAAACACACATCGCATCGTGTAAGTGAACAAGACAAAAGCTATGCATACACGGCAGAGCCCCACTTACAGCTGGTGCCTCTTCCAACACTTTCTGATGAC
GTCGTTGCACGCTGCAGTCGCGTTCAAACAGGTGAATGACGTTTCCATGTTTGTCTCCGAAGATCTGGAGCTCCACATGCCGCGGCTTCGTTAGATACTT
CTCGATCAGCACTCGTCCGTCTCCGAAGGACGCCTGTCCCTCCCTCACACAGGCGTCCAGAGCTTCCTGGAAGTCTTTGTCGTCCTCGACGATCCTCATG
CCTTTGCCCCCGCCTCCCAGCACCG