Description :
From Genome Similarity Track
Location :
Scaffold_115:331014- 333780
Sequence
2766 bases(100 bases per row)
GAGTACTCCGACAAACATGGAAGAGGAAACCCAAGTATATTTAAGGTGGGGGGGGCTTAGTGTTGCTAGACACGAGGAACCTACCGCTTGAATCTGTCAG
TTCTGTCGGCAGCAACAAGCTGAAGCACCGCTTCATCGGACCATTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCATCGACCTGCCAAAGTCAATG
ACGACGCACCCGACGTTCTATGTTGGACGTCTTAAGCGGTACTTTGATCCGCAGGGGGTTGCTGACTCACAGACCCACCTTGACCCAGCTCCTCGAAGCG
AGGGCCGGTCACAGACGTTGACGAGGGCGTCGGGGCAGGCACCCAAGCCTCGGTCGGAACGGCAAGGCTGCGGTCAAGACCGTACGCCGGAGGCGCTCCG
TACAAACGGACCCCGGTGCCATACGCCGAGTCCGCTGAGTACGCCGGGTACGCACCATACGTGTACGTCTGGGAGTGTGCCGCAGGCGGCTCCGGACGTG
GCAGCAGAGCCTCGATTCGTCGGATCATGCGAAAGGCCTCGTCCAAATCAGACGAAGAGGCCTGGCGATCCACCCGCAGATGCATGCTCGCGACCTCTCG
CTCCAACAGGTCCAGGCGGCCCGCAAGACGAGCGAGCTCGCCCTGATTCCCGGCCTGGGCGGCAGCATCGCCGCCAGTCCCAAGGCCAAGTGCAATCTCA
AGCACAAGAACACGTTGACGGAGGCGATCAACCTCAGGGCCCTGTGTCGGACCCACAGAAGAAGCACTCGAACGAGAGTGGCTTTCGGGAGGCGCCGAGT
ACTCGTACTCGTACGAGGGCACCTCCGCCCCTGCTTGACCGGAATGGAGAGGTCCACTTCCACGTGGAGTGGATCCTCCAGGAGCAACGGCGTCGCGGTA
AGCGACAGCTTCTCGTGAAGTGGAGGGGTTATGCCCACTCCGAGAACTCGTGGGAGCCGATTGAACGGCTCCTGATTGACTGCCCGAAGGCTGTCGCAAT
CTGGGAACAAAAGCGGCGGCAGCTTCATAAGTAGTCCTGGGCTTCTTGCCCGAACGGGGTACGGACGTTGAATACACTCCGTACCCGCGCTCATTGTGAG
CGCTGGAAGCCGCACGCTTCATGATGTCCCTTGGCAGCATGCGCTTGCTGACCAAGTGGGCAAACCGAACACGAATATCACGCTGGTCCAGGATGCGGGA
CAGCTGCTGATCTTCATGGAGCTCCCGTAGCTCCGTGGGTGAGTACTTAAGAGACTCCATCCATGCCCAGAACATGTCCTCACAGGAACCCCAGGTGGGA
CAGGTCTCGAGCAGAACCCAGGGGTACCCCAAAGAGGATAGAGACCACCCCGGGTCTCGGGCTTCTTACGACAAGTCGTGAAGTCCTTAAGGGGGATGCG
GTGTGGCGCGAGAAGCACACACCGAGCAGCCTCCAAGTTGTCAACGAGCAACTTTTCCTTCTGAACAAGGGCACGTTCGTAAGTGCCCCTAGAAGTGTGT
CCGCCCACAAGACCACGAGGAGCGACGAGAAGCTCTAGGAAGAGTTCAGCCCCAGAGCTCTCCTCGGGAGGCCAATTCCCTCTTAAGCTGATGGCAGCTC
CCTGGCTGACGGGTGCCACCACCGAACCCCCACGCACACGCTGGGCAGCTTGGAAATCCTCCTGCTGCTGGTCGAGGTTATTCGTGACCCCCCGGGGCTC
AACGAAAGCACCCTTCTCTTCCTCTTCTTCCTCCTTCTCCTCCTCTTCATCCGAGGAGTCGAAGAGGCCCCGATGGGAGTGCCGAGTCTCCTTCTTCTCG
CGGAGTGGAGACTTAGAGGCCGTACCCTTCTTTGAGGGCTTGGCGCGTTCGTCTTTAGAGGCCTTAGCACGCGCAAGACCCTCGGCAAGCGAGAGACGTT
TGCGAGGATTCTCTTCCTCATCGCCACCAGCTTTGGGAGTGCCCTTGGCCTTGACGGCCGGCCTCTCAGAGCGCACAGACGTCCTAAGACTGTGATCACC
TTGATCACTAGCGAGCGACTGCACGCTGTCATCCTTGTGCTCACTGGGGCACTGGGCTGTGCCCTTTCACAGAGCCCGCAGGAGCATCGTGCGTGCTCTC
GGACTCGGCTTCGTCCTCACTGCCAGAGTTGAACTCACGTTCTACGAACCGAGGGCTCGGACGATTGTCTGGAGAGGCCGAGGGCGACGGGCTGCGGCGC
TTGCTTGTTCGCTTGCCCACAGCCGTGTCACCTGAGGAACCGATCGCCTCGGAGGCCATTTGAGTAGCCTCCTTAAGTGCCGAGCCTTTGCCGTGAGGCT
TAGTGCTCTTGGCTTGCGCCTTCCCGGCAGCAGCCTTGGAGCGTGTCTTCGCACCGATCTTTGCAGTGCCACGAGGCATGGTAAACGGTCGAAGTGGAGA
CCTAGCAGAAGAGCGCACAGACTGCTGCTCGAGCTCTAGCTGTGAAGTGAGCCTCCGCCGCCCTCGCGCGGCCAAGTCGACTTTGAGAATGAAAGTTTGT
GACGAACACCTCTTCATTCTGATTGGTCGGTAAACCGAACCTAAATGGGGGAGGATGTACCGGGGTACGTAGCCCCAAGTGTACCCTTGTTACATGAAGT
GTGACACGTCACACTTTAAAAGTATGACACGTCCAACTTCGGGATATTTGGTACTAGGTACCAAGGTCGTCCAAAGCCAACTATTGGATGATGACATTGC
ATTTCTATAGGTGACTTATAGTTTGTATTAAACCCAAGCTTATATCTACCTATAAATATACTCAGT