Description :
From Genome Similarity Track
Location :
Scaffold_96:3310- 6025
Transcript NameFunction/comments
Physo_141237hypothetical protein

Sequence
2715 bases(100 bases per row)
TACTCGGGCAGATTACTGTACAGGATTTGCGTTTGTCGAATTTGCGATTTGCGTGATTTTCTGAAGGCCACATGCACATTTGGTGTGCGAAACACCATCC
ATGTGTGGCCCAACACAAAACACCAAAGGGGGAGCAGCATCATGGCGACTACCGTCTCCGCCGACGCTGCGGTGGCCGCGAGCTTCTCGGAGCTCAACGC
CGCGCTCAAGCGCGAGAACTACTCGCGCGCTGTGGACATTTGCAACAAAAGTGAGAGCTCGTACCATGCGCAGAGGAATCGAACGCGCTGTGTCTGACCC
CGCTCATGCCTCGTGCTGCAGTCCGCTCCAAGCTGCCGGACGACGTGGACGCCGTCAAGGTCAAGTGCGTGGCGCTCATCCGTCTCGAGAAGGTGCGGAC
TGTGTTACCCCTTCACTATTTCCTTCCTTCGGATCCTCACGCCGCGTGCTCCATGTCTCCTCTGTAGTTCGACAAGGCGCTGGAGCTTGCCGTCAAGTAC
GACTTCCTCAGCACGGAGAAGGCCTACTGCCTGTACCGCCTCAAGCAGGATGACGACGCGCTGAAACTGCTGGGTGGTGGCGACCTGGAGACCCAGAGCA
CGGCTCAGCTGCACCTGGCGGCGCAACTGGTACGCCGACCGACTCCTGACTAGGAAGGTGGAGGGATCGCGGGGATCTGACGCTGTTTCTCTCTTTCTGA
AGCACTTCCGCAAGGGCGACTACGACCAGAGCATCCGCATCTACGAACTGCTGCTCTCTCGCGGCCCGGAGGTGCGTATTTGTGTGTGGTCATGGGGGAA
TTGACTACCCTACAAGTGCTAACGAGAATGGATTTTGTGCTGGGTGATTGCAGGGTGACGACCTCCTGGAGTTGCAGACGAACCTGCTGGCGGCGTACGC
GAGCGCCGGCAGAAGCCAGGAACTGAAGGACCGCGAGATTCCGGTAAGCGGACTATGAGGAGGAGTGCTCGCGGAGGGGAATCGCTGCTAATACGGAAGC
TGGTTGTCTTATGCTATCACAGATTGACGATGGATTCGAAGTGGCCTTCAACAAGTCGTTCGTAGCTATCCAGTCCAGTGATTGGGAGGCGGCGGAGGAG
CTTTTGCTGACCGCCGAGCGTAAGAAGAGTCTGCTGTACTGGCGTGCCAACGTGACGTACTGACCTTTTGTATGGGAATAACAGGCTTGTGCTGTGATAC
GTTCGTGGCGGAGGGAGCTTCGGAGGCGGAGATTGAAGAGGAGGTGGCCGTCATCAAGACGCAGCTTGCGTATGTGAAGCAAATGCGTGGCAATCTGGAT
GATGCCCTCTCAGACTACCGCAACGTGTTGAAGCTGAAGTACGCTACGTTGTTGTTGCATCTCTGCTGTGTGTTTTCATTGCTAACTTTTAGCTTTGATG
TTGCTGCAGGCTCCGTAACCGTGCTGTGGGAGCTGTGGCTTCGAACAACATCGTGACAATCCGTCAGGACCGCGACGTGCTGGACTCGTTCAAGCGACTG
AAGAATATCGATACCGCGGTGTTGTCGGACAAGCTGAACCCTACGCAGCAGGAGGCCATTCTCACGAACCGCACGCTGTTGCTGTGCCTCATGAACAAGG
TGCGTCTTGCCTTCTTAGCAGTATCAGGTTTTCCTCACGTTCTAACAAATGGTGAACCTAACGATTTCTAGACGGAGGAATGCCGCGAGAGCTTGGAAGC
TTTGAAGAAGCAGTTCCCCGCGTCGAAGTCGATTGCTGACATCGTGGTCCTGCTAGCAATCAAGGATCAATCTCCGGGAGCTGCTATTGAACAGCTGCAG
GTACGAAATGTTTAGCGTCCAAGCTTGGATCACAGCAGTACTAAGCTCAACTCTACACTCTAATATGATCCGTGTACATTCAGGATGATATGAGTGTGGG
CGGCCGTCTTGGCCTCGCGCACGTGTACTTGACCGAAGGACACGTGCTGAAGGCCGCCGAGTGCATTCGCTCCATTGAGGAGCTGGCGCACTCGCCGGGT
ACAGTGGCCACCCTTGTTGCTCTCTACGAGCAAGCTGGCGACTCGGCGTCGGCTCAGGCCGTGCTGGAACGCGCGTTGATTCACCACAGGGCTGGCAACT
ACACGTCGGAGCAGGCTATGAAGATTCGTGAGGGAGACTGCTGGTACAAGATTCAGAAGAAGCAGTACCGTGAAGCTGCCGACGCGTACTTGGAGCTGCT
GGAAGGCGAGACTGCTGGTGCTATGGACCGCGATCTGCGTCTGCGTTCAATGGCCTCGTTGGTTGTTGCTCTGTAAGTCGCCCAGTGAGCTGCGCCCTAC
TTTATCTGCAGTTCTAACCTTTATTGCTCATGTATGCAGGTCGTTCTGCGATGCCGAAGCTGCTGAGGCGCGTTGCGCCATGCTGCCTGCTGTGGAGGAA
AGCGGAGTCGACCCAAGTGAACTGGAGAAGCAGGCTCCTCGCTCGAACCGTTTGGCTGCCAAGTTTGCGGACACTGGCGACAAGAAGAACGAGTGCGTAG
TGGATACTTGCTCACCATATCCTGTTCGTATCCGCACCTCTAACTGTGTTGTCTTTCCTGTTCACCAGACGTAAGCGTGCCGCCAAGAGCCCGGAGAGCA
TCGCCCGCAAGCGGGCCAAGCGCAGGGAGGCGCATCTGACCAAGCTGCGTTCTCGTCCGGACTACAACGCGTCTATTGGCCTCGTGAACCCGGACCCGGA
GCGCTGGATCCCGCG