Description :
From Genome Similarity Track
Location :
Scaffold_1332:331- 2093
Sequence
1762 bases(100 bases per row)
TCTAGAGTGAAAATTCTCACTGGAAGTCCAGGTAAGGCCCTTTTGTTTGTGAAAGCGTTGAGAACAACCACTTGCGCTTGGGCTTCCGAAAATTATAACA
CATGTCTCCATGCAACCTAATTGAACACTCCTTATGTCGCAAAGAAACCATAGGCCCTAAGCTGAATGTTATTTATAGGTAGCTAAATCTAAGTTAAACA
TGCAAACTACAAGTCGCCTTTACTAAAGCTATATCATCAGCCAATGGTTGACCGCTGGTACAACGTACCAGGTATCCCGAAGTGTGATGTATCATACTGC
ATGTAATCAGAGGTATACTTGGGGTTACGTCTCCCGTGACCCCCCACCCACTAAGTTTCCGTTTACCGACCAATCAGAATTATAAAAATTGTATATCACA
GACTCTCATTCTCAAAGCCGAAATACATCGCCTTAGCTGCGAGAACGCGGCGGATGCTCATTTCACGGTTAGAACCACGCGTAGCACTTGAGTGCTCTTC
TTCTCAGTCTCCAATTCGAGCCCCGTTGCACTGTAAAGAGCGATGCGAGAGCACATTTTATGGCCCCTGTCGGAAAGGCGCAAGCCATGAGCACTAAGGC
TCGCGGCAAAGGATTAGCACTCCACGAGTTCACTAAGGTGGCCTCGTAGGCGATCAATTCATTCGGTGATGCAGCTGCGGGAAAGCGTGCACGCAAACAG
CGCAGTCCGGCACGCTCGGTCCCTCCAGACAGCCGACCTAACCCGTGATTCATTGAACGTGACCTCGGTTCGAGCCGTGACACGAGGCCGAGGCCGAAAG
CACTGACTATGCTCATGTGGGCTCCATGGATGTACAAACTCCAGTGCCCAGCGAGCACGACGACAACAACCTGCTCTGAGCATCGTGCCGCCAAGACAAA
GGATTCGCCCAAAGCTGGAGACGGCGAGGAAGAGAAACCTGTCAAAACGTTCTCTCGCTTACCGAGGGTCTTGCGCATACTACAATTGAGAGTATTCATT
CGAGGCTTGTAGTAGTCGAGTGTTAAGAAGAAAGGACATCCGAAAGTGGTTTTATTAAGTTAGTTGTTCTTGTCTTGCTTTGCTAGCTCCTTTCTACTTT
CCTTCCTAGTCCTCCTAATCACATGTAAATCCAAACACAAAAGATACATTTCGTCGGCAACGCCTATACTCGTCATCGGCGTTGGTGACGTAAATCACTT
GAGTTTTGTATGTGGACTGGATATGCACAAATCCGACCCTGGCATTAACCATGCCACTCATTTGGGATCAGCCAATCAGATATCTCCATTCGACCCACTT
GAACTTATGACCCCTCAGGACACACGCTTGCATACATGTAAGAGTACATAGGCATCGACTGGACTAACTGTCGCGCATAATCCATCCGCCTCGCCATGAG
AAACTCTGGTTCCACCACATCTGCCATCAACTCGTATCGTTCCATCATCTCCTATGCACGAGCATCAACCGGCTGGGGCAAGAAGTCATCAACCTTGATT
CTCTTGAAAGATCCAAGCACGAATGACGGAGGAGGTGGGGCAGACTCCGTTCGTCTCAGTACAGCTGCCTCGATAAATCTGAACGCGTTCTTCGGATACT
TCAACGTAAGTTGGGTCAGAACGTGCTTGTCGCTGAACCAAGAGAAATGCCAGTGGTCGTTTAAATCCGTCAACAAACTCAGCGGATAGCAATTGAGAGG
CGCCTTCATGCTGCAGCTCACAAGTTAACCAATTGCTTGAGGAACATGGCCCGGTTCGACTT