Description :
From Genome Similarity Track
Location :
Scaffold_2045:331- 2085
Sequence
1754 bases(100 bases per row)
CTCTGGAAGGGGGACACCAGGGGATCGGGCGTACATATCAGCCGATCCGCGATAACTTTCACTGGAGAGGTCTCTTCAGAAGTGTGCAGAAGTACGTCGG
CGAATGTGTCGACTGCGAGACCGGCAAAGGACGACCCACGATCAGGGGCGAGTCGCCGGGAAACATCCAGGCGACATACCCGTTCCAGATCATAGCAATG
GATCACATACCTTCGCTACCCAAGTCGTACAAGGGTAATACGGAACTGTTGATCTGGGTCGATCTGTTCACGGGATACGTGATCGCGAAGGCCAGTTCCT
CCCGAACGGTGCAGACGATCGCCGAATCTTACGAAGAGTGCGTGTTCCGGCGATTTGGTGCTAGCGAGGTGATCAGGCACGATCGAGAGCCGGGATTTAT
GGCTGACTTCTTCCGCGCCTTTAACAAGGTCCTGGGTATGCGTCAGCGAGCGACGATGGCATATCGACCTCAGGCTAACGGTACTGCAGAGCGAATGGTA
CAGACGGCGACGAGGGCCCTGAAGATCTTCGTGGAGGATCTGGATCAGAGGGATTGGGATGAGTACGCAGAGCGATTGACCTTCGCGATGAACACGGCTC
AGGATCGGGTCCGTGGAGACTCCCCTTTTTATCTGGTGCATGGATGGGATCCTCGATCGACGCTCGAGGCAACGATACCTTTGGGTAGTACCCGGACTCG
GGATCGGGATCCTCGACGGTGGCGTTATCGGATCCAGAAGCACTACGATCAGGCTCGAAGTCAGGTGAATGCTCGACTACGCGAGGCGATCGCGGATCGG
GCCGATCGACACAATGAAGAAGTTCGACCGCACTCGATCGAAGCTGGATCTCAGGTGTGGCTGTACCTGGATCGAGTGAAAGAGGGGTATGCCCGGAAGT
TGGCCCACCTGTGGCACGGCCCGTTCCGTGTTGCGGAGAAGATGAACGAATATACGATGAAGCTTCAGATCGCTGGTACGGACTATCACCTGTTCCCGAT
CGTGCATGTTTCGAAGCTGAAGCTGGTCAGGGACTTCCCCGATCGACCGCAGATCGCGCTCACGGTGGACGCAGCGGATCGACTCGATTTCGACGAAGTC
TTACTTCCGGAGGACAGCTGGGCCCCAGATCGAGACGCGAATGAGTACGAAGTAGAGGAGATCACGGATATGCGGACGGGTCGAAGGACGCGGTACGACC
GGACTTATCGAGAATTTCTGGTGCACTGGAAGGGTGACGACGAGCCTGACTGGGTCGACGAAGCTGATCTCAACTGTGGAGCTTTATTGCACGAGTTCCT
TCGAGATCGCGTGAACCGGAACCGATTCAGCGCGATGCAGTCTCGCGAGGAGGAGTGAGATCGGGTCAGCTTGGTGAGAGAGAGGGATGACGGATCGACG
GGGAGGCCGTTGATCGGAGGAAGGGGTTGTATATGAACGAATGAGTGTACGTGAGTGCAGATCGGACGGTTATGGAGTGAGTACAGGAAGACATGAGGAC
AGATCTTGGCCGATCGAATTAACAACGAATGGATTGACGGGGAACAGTGGAAGATCAAGGAAGAATGTGGGTTATTACGATGGAATGGATCAATCTGAGT
ACTTCGCGCTACGTGTATGGAAGATCGGCCTCCGCGTCACTCCTATTCTTGGGGTGTGATGGTCGACTGGCTCGGTATTCGCGGAAGTCGATCGTGGAGA
CGGCAATCATGTCACGGCTGGTGTTGGGCGCCGACGTTGGGGTTGAACTTGTTG