Description :
From Genome Similarity Track
Location :
Scaffold_1013:331- 1940
Transcript NameFunction/comments
Phyke_g11814reverse transcriptase

Sequence
1609 bases(100 bases per row)
CAGATAAGATCGCAGCCCATCGTCCAAGTCGGCCCTGAAGTCCTGACGAGTTCACCAGCCAAGCCAGTGTCGAGTGTCGAGTCAATACCTTGATCGACCT
CGATACCAGCTGGGTATAGCAGACATCAAGAATCCGAAGCAGGGCCAAGACTTCCTTGTCGACGATCCCATAGTTGAACTCGTTCGACTTCAGCGTTCGA
CTGGTGAAGGTCACTGGCTTATACACGCCATCATGCTCCTGCATCAACGCAGCGGAGATTGCCCACTTGCTCGCGTATATCACTGCGACCGGAGTTCGAT
CCGGATCGAAGTGTTGCAATATTGGGACAGTCAcgatcttgttcttcagtATGGTGAACACCACTCGCGCTCGGACCCACTTGTCATTCTCATCGATCTG
CAACTCGTCGCCCCCAGTCTCGGCACTTACCGCCTCGATCTGATCGCGTCGATCTATCTCGTAAAAGTCAGTTTCTCGCAACTCGTACAAGATCGCCGCG
TAGATCGCGAAGTCTTCGATAAAGCGACTGTAATAGTTGAGACTACCGAGGAACGATTGCACCGATTGCAATGTACGAGGAAACGGCAAGTTAACCAAAG
CATCGAGGTCCTTCGGATGCGCTTCAAGACCGTCTGCCGAGACACGGTGACCCAAATAATCAACCTTGCGGTAGCCCCAGAAACTTTTGGCTACGCTGAT
CGATAGGTTTCATTCGTCATAGGTGTCCAGCATCCTCTCGACCTTGTTGCACATAGAGTTCCATGATCCAGCGGCTACCAGGATGTCGTCGATATATGAT
CGTCGACCCAACACAGACGGCTTCGGATCGGGTTCTGGCTCCCCCACTTCGAATAGATCAACTAGCTCGGAGCGATCCGTGCCAGCTGCGATCCGGAGGT
AGCCGTACAGCGCGTTATCCAGAAGCCTCTGGTAGATCTGCGGAGCGTTCTTCAATCCGAACGGCATACGAAGCCACTCGAAGAGCCCGAATGGGGTGAT
GAACGCAGAGACCAAGCGAGCGCGATCTGTCATCGAGACGACCCAGAATCCACTTGCCATATCCAAAGAGCAAAACCACAATACCTTGTCCAAgtcttcc
agcagatcgttGATCAACGGCATGGGATATACCATCAAGCGTGTCAGGCTATTCACCTGGCGATAGTCAATGCAAAGCCTGATGTCTACaccgttcttct
tgatgatcacCACAATCGGTGATGCCCATGGAGATCGTGACGGCTGGATGATCTTTGCTGACAGGAGACTCTTTATCAGATCGGAAAGCTTCTCTCGGAA
CTGTGGTGCGACCTTTCGCACGCGTTGAACAACAGGCTTCGCGTCACTGCACCGCGTACGGCTGGTGGCAATGCATTCCCCTTGCCGACCAGAAGATATC
GGTACCGCCAAATGATCTGTCTTAGTCGGTCGACTTCTTCCGGCGTATTCACCGCTAGATCGCCCACTTGGATATCCTCGATGGCGACGTCTTCAGTAGT
CGTTGTCACTTCAGGCAACACTGCCATCTGATTTTCAACGTCCTCTGCGAAGAGGTCACCACCTTCATGGAAACAGACTTGTTCCTCTTCAGGCTCTGGG
GTAGCCAGT