Description :
From Genome Similarity Track
Location :
Scaffold_773:331- 1620
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_773-snap-gene-0.6Nipped-B
Pytir_DAOMBR486maker-pir_contig_773-snap-gene-0.7Transmembrane protein

Sequence
1289 bases(100 bases per row)
CGGTTTATCATGGTCGTCAACATCCAGCTTTGTTTCGTGGTGCTCTACCCCGCCTACACGTTTATGCTCAACAGGCTCTCGGGGATCCCGCAGACGGTGT
TCGCGCTCTTGCTGCCGATGATGAAGCTCGGGACCAAGAACGTCATGGATCTGTACGTTCGCAACAACGAAGACACCAAGACCGAGTTCGCCAACTTCAA
CGTCGAGGTCTTCTACGTGCTCTTCGTCGCCAGCTGTCTGCAGGGCTCGACCTCGTTCAGCACCACTGCGCTGATTATCGCAGTCGACCTTGTCGTGGCC
TGCGCATCGATCTACGGCGTGGACATCATCTTGAGCTCTATCCCGACCGAAATTGCCGCTCGAGCAGCTACCACGCGGCAGCCTGGCGCGCGTCTCACCG
CTGCCCAGCTCACCCAAGTCTGCGGGGCTGCTGCCTAGAATACCACACTCCAATCAGCATCAGTCGTAACTACTGACCGAGCACGACAAGCGCGTGCTGC
TCTTGATGAGCGAAACCCACCGACTCGAGTTGGTGCAGAAGGTGCTCAAGGTGCTGCATATCACGGAGTCCATACTCGTCGTGGAGTTTATCGAGGTGAT
CATCCCGGCAATATTCAGTGGGTACCAACCAATGTCAGACATGGAGTTTGCTTGTGTGTGTGATGCGTGATTGGCGTGCAAAGATCTCATGAAGCTCCTC
GCTCTTCCATGTGTGTTTCTGCGTCATCCATTGCTTTTAGGCACATCCCTCGTTGCAAGCTACGAGCTCCCAAACCGCGCATTTTACATCTTCACTGCAA
GGCGTCAAGGTGGACCAGCTGTCCGCCACCGTCGCGAGTGTCATGCTCTACTCGCTGCTCGAAGTGCTCTCGCTGACGTTCTTGTGCGTGATGCTGCAGC
GCAAACTGCGCATCTCGGCGCTGCACCAGCTCGCGTTCGTGCTCAGCACGCAGTGGCGACAGGCGCAAGCGAAGCTCGTGTTCTGGATCGTCATCTCGCT
CGAGATCATGCTGCAGCACTTCGGAATGGACTTCAGCTTCCAGTTCACATGGCTACACAATCCTCCAGCAGCTCTGTGAAAAATGACAAAGCATCGCCTT
GCTTATCTGCATACCTCACATGTGCATACTTTGCGATTGCGTGAAATGTCGTTCTCCCCAATCCATACACACATTAAGTCAAAAGGGGGAGGGGGCCTCT
ATAACCTGATTCGGGATTCTCAGTTTGATAAAATCATATAGCAGAGTAAGACGAAAGTTGCTGTGCAGCTCCGATCGAAAAAATTTTTA