Description :
From Genome Similarity Track
Location :
contig_17:331- 1535
Transcript NameFunction/comments
g4960.t1hypothetical protein

Sequence
1204 bases(100 bases per row)
GCGACAACGGTGGCGAGTACACTTCCGGCGCGATGGCCAAGTTCTGTGCGGACCGCGGTATCGTGCAGAAGTTCACTCCGCCGTACACGCCTCAGCTGAA
CGGAGTGGCCGAGCGGATGAACCGGACGTTGGTGGAGTGTGCGCGCTGCATGCTGGAACATGCCGGATTGCCCAAGACGTATTGGGGTGAAGCGGTGATG
ACGGCTACGTTCCTCCGTAATCGGTGTCCGACACGCGCCATCAGCCACGACAAGTCTCCGCACCAAGTTTGGACTGGCAAGAAGCCGCTGCTGGCAACCT
GAAAGTGTTCGGTTGCCACGCGTATGTGCACGTGCCGAAGGCGAAGCGCACCAAGTTCGACGCTCGGTCGGTGCGCTGTCGGTTCCTGGGGTACTCGGAG
CACGAGAAAGCGTATCGATTCGAAGAACTGGAGAGCAGTCGCGTGCTGGTGAGCCGCGACGCGCAGTTCATGGAAGACGTCTTCGACAGTGGGAGACGCG
ACTACCATCAGAGGGAGGTGGTGGTCATTCAAGATGAAGAGACGACGGATCAAGATTCGTCGCAGTCGGATGAAGACGACAACGAAGAAGAGGAAGAAGA
GAAGCTGCGCGGGACGAAGACTTCGGGCCCGGCAACAAGCGACACCCGCGGACGCAGTCGCTGGAGGAAGTCACGGAGGTTCCAAGTGCCAAGCGGTATG
CGTCGCAGAGTCGACACCAGACGCTGGACGAGATGTCTGCTGCGGCTCAAGAAAGTCAAGACTTCGAAGCTGCGTACGTCGTGGATTCAGTGGGAGAAAT
GCCGACCACGTTCAAGTCGGCGATGGAATCCAGCGACGCAGTCAAGTGGAAGGAGGCGTGCGACTCGGAGTGTGACTCGCTGCTCAAGAACGACACGTGG
GATGTCGTACCACTGCCGAAGGGACGCAAGGCGATCGGCTGCAGATGGGTGTTTCGCGTGAAGGAGAACCAAGCTGGAGAGATTGAGCGGTTCAAGGCGC
GACTGGTGGCCAAGGGGTTTTCGCAGAAGTACGGCATCGACTACGACGAGACCTTCGCACCAGTGGCCAAGTTCACGTCCATCCGGATCGTACTGAGTCT
GGCTGCCAAGTATGGTCTCAAGCTGCACCAGATGGATGTCAAGACTGCGTTCCTCAACGGTGTGCTGGACGAAGACATCTACATGGCACAGCCGGATGGC
TATG