Description :
From Genome Similarity Track
Location :
Scaffold_111:33093- 34696
Sequence
1603 bases(100 bases per row)
GTTCGATGCTGCCAGCTGACCCTTGGCTCGCACCTTCTGAGCCAGAGTAACCCTAGGATGACATCAAAATTTGTCATCCAAATCAAGTACGATGAAATCA
TCATTGTACTGCAAATCTTCTAACGTGTAGCGAAATTTCACTACACGTTTCATCACTGCTATAGATGCGCCTGTTGCGAGGCTCACCGTTAGCCTCGTAG
GAGGAGTAACGCGCTCAACGAACTTGAGCCTACGATCTTCTAGCGACTGGCGACGAACAAAGTTGTTCGACGCCCCACAGTCAACTAAGACACGAAGTGA
CAAACCTTTTTCACTTCTAAATTCAAGATGATGAGGGTTACCTCATGACCAATTGCAGAGACACACAAGGATTGTGAGTCTGGAGCAACTTTTATCAATC
GATTTGCAAATTCTATTGAGGTTGCTGGATCAGTAGGGCGCTCCGCCCCTACTGACCCCGACCGTTTTTTTACGGTCCGCTACGCTGTTGTGACTTCGCG
ACAGCGTCGGATCCACGTCCGTTGCCCTTCTTGGCGGACGGTCGGGAAATTTCCCAGTGTTTCGAGACACTGGCTATGTGGCACTACACTCATAAGCGTA
GTGCCCTAGCTTTTGACAGCGATTGCACTTTAGCAATCGCTTATTGCCCGAAGAGCGAGGTCTCTCGCTCTTGACACAGCAGAGGTCCATAGGTTCTGGA
CCTCCGGTATCCTGTCGTCTCTGTGGACGATAGGAGGACGAGTTCATATGAGCTTGTCTCATACTGAAGTCTTCCTGTTCCGCAACTGAGATCGCTCGAT
CGAGCGTATCCAGTTCCAGGCGAAACAGGTGGGTCTTTACGGGACCATTCATAAGACCCTTGATAAACACAGTTACCTGTGTTTGTTCATCAATCGGCTT
CGCCACGATACAACTCACGAGGTATCGTGTGTTCTGGGCGTAAGCGTGCAAGTCACGCTTATCCTGCTTCAAATCCAGGATCTCAGCTCGAGCCCTGAAT
TCGGCACGCGGCGGTTCAAACGTTTGTCTGAGCCGCTACTTGAAATCGTTCTACGACTCAAAAGCATATGGGTCGTGAAGCTTGAGCCCTAAGGCCCAAG
CTTTAGCACGTCCGGCTAGGTAGGACATGCCAAACACCTCCATCGCATCATCAGTGATGCGACGGCGTTCGATGGCGTTGTCAAGTGCGACGAACCATTT
CATGAGGGATTCACCCTCGACTGCCTTGAACTTTGAGATGTCAATCTTCAAAGGTTCGGGTCAACGCGCATGCATCGGCCCGCCAGCAGCAGCATTATAT
TGCTGTTGCTGATGGTAGAGCGAGGCTACTTGAGCCCGCGCCACATCAAGTTCATTCTGCATGAACTTGGTTACCGCTGCATGTTGCTCGTCTACTTTAA
AACCGAGCAACATTGCACTGACGGCAAGGACACCCATGATCGAACCCATTCGTTCGACTGCCGCCCATTCGGCATCGCTCAAATGGGGAAAGTCGTCACG
TGTTACGTGACAAATGGCATCGTCATCATCCAACATGCCTAAGTTCATTTTGGATGGAATGCGGTCCTTGGACGGACTACAAAGTGCTACCAGGTGTAAC
AGG