Description :
From Genome Similarity Track
Location :
Scaffold_1720:3309- 4588
Sequence
1279 bases(100 bases per row)
TGGGGTGCGTTCTTCAATCCAAACGGCATCCGGTTCCACTCGAACAGGCCAAACGGTGTGATGAATGCGGATATTGCGCGAGCTCGATCCGTCATAGTAA
CCACCCAGAAACCACTGGCAATGTCTAGAGAACAGTACCAGAGTACTTTATCCAGATCTTCTAACAGCTCATTGATTAGAGGTATCGGATACACCATCAA
TCGAGTCAGGCTGTTAACCAGTCGGTAATCAATGCACAGACGTATATCCACCTCGTTCTTCTTGATGATGATTACCACCGGAGATGCCCACGGGGACGTC
GAGAAACTGATGATCTTGGCTTGCAGCAAGCCCTTAATCAGATCAGATAGTTTTTCTCGGAGCTGAGGTGCCACCTCCCGCCCCTTTGAGCGATCGGTTT
CGCGTCGCCGACATCGATGTCACATTTGACTCCGCGGGCAGCGGACGGTAATGCATTACCTTTTCCAATCAGCAGACGTCGGCTTTTACAGATCTTCTGC
CGTAACCGATCCACTTCCGCGGGTTCATTCGCCCCCGAATCCACTTGGATGTCGTCAATCGCGACCTCCTCTGTGGTCAGTGGTACCTCCGGGATCACCG
CCATGTCTTCTCCGAGTTCCTCGGCGTGTAGATCCCTGCCTTCATGGTAACATACTTGTTCATCTTCAGTCTTCGTCGGATCCACCATTGGATCCAAGCA
CCGCGACCCTCTTTCACCCGTCATTCCTTCTGTCTTCGTGGGATCAGATACCCTGGTACCGGGGAAGCCACCCTGTTGGATCGCCTTGATCCCCTAGCGA
GCTTAAACACGACGGTTCTTGTTTGGCTAGTGTTGCCACTCTCGGCAAAGATCCAGGCACTTTGTCTAACGGAAAACTCGGATCCACTGTGGGTCAGCAG
GATTCGGCGACCCGGCTTCGGTGCTCGGCGATCCTCCATCCACCGACTCTGGGGTATCTAGGGACAGGCTCTGGGGATCGTCCCCGGTCTTGGATCCAAC
CTGTATCGCTTGGATCTCAATCCGACGATACCTCTGTAGGATCTTTCGCGGAGTTGGGTATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTCCGCCGGG
AGCTCCCTTTCTCCGAGCGATTCGATCTCGGTAGTCGCCTCGTACGCCAGATTTTGCCATTCTCTGTAGCGACGAAATCCCACTGACACATATCCAGGTC
GCCTAGGGATACCGTCCTTCGCCAGCCATCGCCCGATCTCCTCATAATGGTTCAGTAATAGTCTCTTGTCGCTGACGTT