Description :
From Genome Similarity Track
Location :
Scaffold_2:33081- 34147
Transcript NameFunction/comments
Physo_325754taurine dioxygenase, putative

Sequence
1066 bases(100 bases per row)
AGTACCGGATCTCGCCGTGCGGCGTCACACGAACCGCGTGGCGGTTTCCCGGCAAGAAGTCAAACGTGGCGTAGTGGAAGGTCGAGCGGTTGTTCCAGAT
CGCCACTGCGTCCTTGGTCCAGTGGTAGCGGACTTGAAACTCGTGTCCTTCGGTGATGTGCTTGTAGAGAAATCGCAGCACCGCATCTTCAGGGTAAGCG
AACAGTTGTTAGTTTTGCAACAGCAGTCGTAGCACTGGTTGTATATCCATACAGAGGGAAGAAACCTACCCGATTCAGCTGCAGACAGGTTATTGATGCG
CTTCGTGAACGCGGCGTTTACGAAGAGTGCTTTGCGCTTTGTTACGGGGCGCGTACGGACAACAGGGTGCTCGAACTCAACCACTGGGCGGCGAACGATG
CGCCCAGCTTCGATGGCATGTTCAGCTTGGCTCTGCAATTGACATATTGTTAGTGTCGCCGACGCAGCGGTAGAGTAAGCTATCCGTAGAGTGATCGTAC
CTTTCCGCTGTGAACCGCGACGAGGCCCTCGAGAAACTTCTTGAACGCGGGGGTGAGGCGGTCGTACGCTTCGTAGCCGCATGCCCATAGCGTATAGCCA
CCGACATCAGGGACCGTGAGCGCCGTAGTACCGCCCAAGCTCCAATTGCTGCTCGGCCGTGATTTTCTGGTCGCGAAAGAATACCACGCCGCGATGGGCG
ATGAGCAGCGCCAGCTCGTCCTTCTGAGCGTCCGTCAGCTCGTGTAGCTGCAGGCCCGAGACCTCCGTGCCGATCTTCGGCTCCAGGTGCGTCACCGTTG
CGTCGGCCAGCAGGTTCTTGAACGTCGGGTCGGCCTTGAGTGCGCGGTCCTCGTACGGGACAACCGGGATCGGGTCGTACGTCGTAGGTGGGAAGGTGCT
CAGCAGCTCCGGGTGCTCGAACTTAGCGTGCTGCACTTCCTGGAATAACGCATTCTTCACGGGAATAGCCGTAGGGGCAGCGGCGGAAGTCGTCTGGGAG
TCGGTATCTTGGTTCTTGGGGCCATGGTTGCTGGGTCGTTGCGCGCTTAAAGCAAATTGGAAAGTG