Description :
From Genome Similarity Track
Location :
Scaffold_165:33080- 40069
Transcript NameFunction/comments
Physo_144081hypothetical protein
Physo_144082peroxisomal protein PEX19 family protein

Sequence
6989 bases(100 bases per row)
TCACCACTGGGGTCTTCAGCACCTTCCAGACTTGCAGGTCACCGCGTCTTATCGTCTGAGACTCTCGCAGCAGCCCCATCACACGCACCATCAACCCTCC
CTGCTCCATGTCATTCTCAAAGCAGTAGACCTCCTTCATATCTTCACCAGGAGCGAGTCGCAACCCAACCCGAAGCATCTTGTGCCACTCCCGCCTCTTC
ACCACTTGCAATTCTCCCACGAATCCCTCTGCGGTCGCCGGCCACACCGCCACACACGAGGCTCCTCCATCCGTTCTCTCGAGCGCATCTGCCACCGCCT
CAAAGGCCCTCCCCAACGTCGCCGCGCCCTCCATCCCGGCACTCCTCTCTTACACTGACCGTTTTACTTCAACTGACTGACAATCACTCTTGACTCGGAA
TTAGTCGGATATCTTTCTGGCGGGAAAAAACGGCCAGCCCCAGCAGTATTCGCGCCACAATTCCCCAACGTATCAATCGATCACCTAACTGGCGGGTGTA
TGGAGCCTCTGCGGCGCGCGTCGGGCGCGTCTGCGCGCTCGGACAAGTCCGCGCTGTCGGACGTGTCCTTCTCGCGGCCGGACAGCCCGCTGCTGCGCCA
GAGCGACAGCTTCGCCGAGTCGCAGCAGTGCAGCGCCGACCCCAGCGCCTTCCTCGGGTTTCACGTGCCGCCCAGCGCCGAAGAGATGGACGTGGCGCTG
CCCAAGGGCCCGCAGCCGCCGAGCAAGAAGAAGACATTCAAGCTGGTGCTGGACCTGGGTCTGGACTCGACGGCGTCGGGGGTGCGACCCCTCCAGAGTC
CAGCCAACCCTTTCAGCGAGCTGTTCGCTGGAGACACGCAGGACGAGGAGAATCTGATGGCGGCTCGCCCTCCAATGGTCGCTGAAAAGAAGGAGACGGA
GAGGAAGAAGAATGATAGTAAGAAGGAGAATATGGAGCGGAAGATGGAGCATGTTTCTCCTCCCAAGAGACGGCGGCCGAGTGAGGAGGAAAAAGAAGGC
GACAGGTCGCCGAGTCCACCGCCGACAATGTTGTCATCGATTGAGAAAGAATGGAGAGATCATAAGCAGAAAGTGGCGAGTGGGAAAGCGGTCACTGCTA
GTGGAGTGAAGGATCGGGAGCAGGAGCAGGAGCAGGAGAGTAAAGTGGAGAGTAACGACGAGACGCGGCTTGACGATTCGTTGCCGGGGGCGAGTGCGTT
CTCGGAGTATAGCGAGGACCTTGCGCCACGCGTTTTCCAGAAGTTTACGGCGTCTGCATCGTCGGTGGAGACCCCGGGTGATAATGAAAAAGGTGAAAAG
AACGCTTCGGTGGATGGCGACAAGGACCACTTTGACCTGAGTGCGTATATAACGGGAGATAGTGACCGCGAGACAGATTTCGAGGAGGACTTGGATTGCA
CGCAGAAGCTCGAAGATGATGAGGAGAATGTGGATATGGACAGCAAAGATGTGACGCGAAGTTATGCAGATTCTAGCGGCGGCGATGAAGGGGAGACAGA
AGCGTTCCCATACTCCGATACGGGCACACAGCCTTATGGGCCAGATTCCACGTTCATGGATGATGAAAATGACGGACATGCGGAGAACGATGGAAATAAG
ACTGGAGATATGAGAACGAATGGAGGAGATTCGGATCATGCACCAATGCCGAACCAAAACAGTGATCAGCGGGGAAGTGAGGAGGATGTAACGAGCCGTG
AATGCACCCAGCAGGAATATTTGACGCCGCGAGTCAATCCCAGTCGAGCTGAAAAGGTAGACGTGGGCGAGAAGTCTGTCGTTGTTCCTATTGAACAGAG
CTCCAAGTCACAAGATGGAGATGATCAAGACGACTGCGTGTCTACTCAACCAAGCAAAGGTCAAACAGAGGGCGAGCCCGCTGTAGAGCCGATTTCACCG
ATTCAGCAACATACCTCGCAGAAAAGTGGCGTGGTTGTGACGAGCAAGCCTTCGGGGGCCGATTCACAGACAAAAGCAATCCGCACTCTTGAGTTTTCGT
TCTCTATGCCCGAGTCACAAGATGGTGAGCCGCACTTCAGTGCAAGTCTTTCGATTGATGGCGTAGTGGTATCGAAGTCGCCAGGAACTCTATCTAGAAA
TGACAGGCCGACCCCGTTCGAGTCGTCGATCAGTCCAGTATGGCCGCCAACTCCAACTCCCACGCCAACACCAGTAGAGGATCCTGTCGTTCCGGAAGTC
ACAACGGGGCCAACCCAAGGGGCCCCCAAAAGGAAAGCTGTTCCCGCTGTCCAGTCTGGATTGCCCACAGGGAAAAAGAAACAGAAAACCTTGTCTCAAA
CCTCCCAATCTTCAAGCCAGACCACTTCCCCTCCGAAAACCATGAAGAGAAAGCGTGGATTTGTTTCCCCTGGCAGCAATGCGTCGTCGACAGAATCTAC
CACTGGGGACCCGTTGACACCGCGACCTCCAGCAAGACGCAGTACTCGATCCGCCCAATCAACACCTTCTTCTTCAACACCAACTGTTCGAACACGTACT
CGAACGCTCACCCCAGTGCCAGCACACCGGACGTACGCTTCAAGGTCTCGAACACTTTTCAAGTACAAATTCGAGTTTTGCCTAACGGGTTTTGTGAAGA
CGGGCGAAGAGAATTTGAAAGAACTGATCGACGGACACGGTGGCAAAATCCCCGAGCGGTATCAAGACGTCCTGTACAAAAACAATCGCAAGGCAGTCGT
GATCGCGACGCCTGTGTCATGGCGCAAGCGCAAGTTCATGCAGGCTATTGCTTGTGGAATTCCTGTCGTTCATACCGATTGGCTTAAGGATTGTATCGAA
GCTGGCTATGTGATACCCTTCGATGGGTATCAAGTGCCTGCAGGCTACTCCGTTACCACTCGTAAATTTGAGTGCTTCACCCCCAGAGAGGTAAGCTTCG
CCGCAACAGATACGAGCTACTCCCGGCTTGGTTTGTACTGACTGTTGCCATTTGCGTTGATGTGACCAGCTAAACATTTTTGAAGGCTATTCCTTTGGCA
TCGCTACTGATGTTGAACAAGTGTCGAAGGCTGAAGCAAAGGACAAGGCCAATTTGATGGCGTTTATTTTGAAGGCGTGTGGTGCGGATGCTGTGTATGA
GGTTAGTTAATTTACTTTGTGCAAATTGCCGACCACGTGGTGTTTCTTCTAACCGTCTGGCCCGTTGCTTCCAGAATTTATCCGCTAAGAGCGACGTCGA
CGTGGATATTGTGTTGTGCGGCGAGTACACGCAGGTAAGGCTGGCTGTGTTGTATAATGCTGGAACCCGACCGTCGCTAATCATAATATTGTGCTGTGTA
AATGTATAGACATGCCGATACTATAAGAAAAGGCGTCGCATTCCTGTCAAAGACTTTCAATGGGTAACTGAGTGCATGCTCCTTCAGGTACGTAAAAGTT
GCATCGAAACAAATAATTCCCCTCACTAATTTCGTTAATGTGCTTGTTTCTCAGCAATTCGTAGACCCTGATGAACCCGTCTTCGAACCCCAGCGAATTG
GCTGCGAAGACGTTTTCTCAGCAAGCGCTGAAATCGGCGATAGTGACAGGTACGGCTTACATGTTTGCTTACCTTCCGTATCGATAGACACCCCTGATCT
TAATACTCTGCATTTTGTAGGACCACACTGAAACTATACACAGGAGAGCTTGTGATGGCTGACATATCTGGCAGCGCAGCTGACCACTATCTCCTGTTCA
ATGTGTGCGAGATCCTTAGCATTCATGTGAGTGCTGGCCACAAAGATGAAGCCTCCCAGTCAAAGCGTAAAGACAAAGGAAACCGCGTGATGCTTCATGT
TGGCATGCTCAAACGGTACGTCTTCTACGGTTGATGTTTGGACATTTAAGCGTGCATTGACCGAGTTCTTGTTGTACATATATTTTTTTAGGGAGCCTTA
CAACCCTGAGCTCTCGAAGACCCCTGTCAAAGAGTTAGATATATCGTCGTCCCAAGTGAAGAGAAGAGTCGTGGCCATCTCGAAGGAGGACTACGACAAG
CTGAAGTATAAGGACGAGAGCATCTTCTACTTGGAAGATGCGAGTGATCCCGACAAACCCTTTCAGTCGGAGCACAGGTGGCTAACGCAATGAATGCTTC
GTTGGTCGGCCGCTGCTACCATGGCGATATTCGATACTCGGGTGTTGGTTGGTTATTGTTGCTGATCCTCTGGCCCACCTTGTTGTTGTGCACTTTGCTC
GTCCAGCAGCATTCGGTTTGGAATAAATAGGTGAAGCCATGGCTGTCATATACGAGACACAAACCCAGCTTTAGTGGAGATATACAAGTGCTGGAATCCA
AAAAAACCTCGGCTTTGTACCTTCCGCATTGGGTCAACGCCAGTGTCCGAGAAGATCGTCTGCGTCGAAAGCAAGAGTGACATCAGTGTGGATCAATTCC
TAGACCTGTATCGTCGTTCGTGGGAGCTGACGCACTTGCCACGAGATGATACCCAAGTGAGCAAGCATCATGCGGTAGTAGTTGGTGAACGTCTCGGCCA
GAAAGCTCCATTTGCCGCGTAAGTCCCGAAACCAGATTTGTGGCGCTACTGGTGATACGTTGCGGTGGTATTAGATGGCTATTGGGTTTTGAAAAGTAAC
GAGAGAATACCATCGAGATACAGGAGCACAACGGTGCCGAATTTTGGAGATGCCTCAAGCGTAAAACCTGTAATCTCCTTATGACTGGCCTGTAGCCATT
TTCATCGTCAAAAATAAGTTGCCGGAATCGCTTCCTCCCAGCAAAATACCTTTCTCAAATCCAGTCGATGCTGATCCAAAGCGCAACACTGTGCGGGCAG
GTCCTTGATCACGACGCGCTGCAAGTCCTGGACCGGGTTCAATAGGAAATGGCCGACCAAAGTGGAGTGATCTGCATGTAAAAAAAAAAACTTCAGCCCT
GGTGCTGAGGAATGCGAATGTCAAGAATGCCATACCGCGAAATGGTGCAAACCACTTGACGGAGAGTCCGTTAGCGATCGAGTAGAACCGCTTCAAGTCG
TCTGGGAGCACACACGGAGTGTTTTTCTGGTGTACAGTTAAGATCTGGAATAACGTCTTCCTTTGCCAAATCCACTTACCTGCTCCCATATCCCAAACTC
CACCTGGGTAGCCCCAACAAACGGCTTTGACTCGACGCGGGACACACGTTCGTGGGCCTGCAAGTATGAGAACACACCTAGCGATATCGCGTCGAGGTGC
TGCATTAGCCTGCGTCTTTACAAATCTGGCTGAACAGGCGCCAGAAGTCCAAGATAGCGATGCAACAGGCAATGGTGTTGCAATTCTCTAGCAATGTTAC
GACGGAATAGCAGCTACTACTAACGATTTTCTTCCAGCTTCAATATGCGCGATACGGTTTGACTACATCACTGAGCACTGCTCTTGGCCTGGGGCGCCAC
CAACTGCACCAATGATCAACCATAAATGGTAAGTAAACGAACACACAGTTGTAATGCGAAGTGCACGCATTGCACTCACGGGGCATTCCAGGCATTCCAG
CCATACCGGGGAACATACCAGGGCCCTGCGAAGTAGGAACACACAGATCAGTCGTGATCCAGCGGCAAGATTTAATGTCATGCAATGATAGACAAACCAT
GTTGGGCATGATCGGCATTCCTTCATCATCAAATTGCAAGCCTGTTTAAACACATCGAGCGCAAAGTCAGTGGAAGATGGCCTTAACACATAATGCTTGC
GAAACCAAAATGATTACCTGGAGCAAGATCGTTCACAATCTCCGAGGGAGGCTGGCCAGTCTCCTGCACCTCCTGCATAAGTTCTGACAGCCGAGCAAAA
TTGTCGGGCTCCGACTCGTACACCGCGACGATCTGCTGGAAGTACTGGTACTGCTTGCCATATCTGTGCTCAACATAACATCGTTAGGACGACAGTCGAC
GCCAGCCAGATGACGAAAAATACGAACCGTTCGTAGTCTTCCTTAGACAGCAAAGACTCCTTTTCAGCCAACCACTCCGGATACTACAACGACAAAAATA
AATCCAATCAGTTTTATATCAAGCACCAATCTCGCACCGTTACGTACCCGCTCGCAGATCTGCTTCATGGGGTCGTACATGACGTCCTTGGACAGCAATT
GCTGCATCATACCGTCCACCAAGTCCTGGAAATCGTTCTGCAACCGATTCATGCAACAAGAACACCACACACCACACCTTGTCAGCGCCATTCACCCAAC
TTCACCACCTATCACCTATAAAATAAAACATGACAGCGAACGCACCTTTTCGCCCATCTCCTCGAACTTCTTCATCATCTCGGCCATCATCTCTTCGCCC
ATAGCTTCCACCTGCGCCGTGCCCACGCCTTCCATATCCTCCGCCGCCTTGGCCATATTCTGCAGCGTCTTGGCCACGCCAGCATTGACATCGTCCGTCT
CATCGGACGTCGAGTCCATCTTCAACGAGCCCAGCAGCTGCTCAATATTGTCCCCGTCGGCTAACAACCGCACCAAAGATCAGTATCCCTACAACTCCAA
CCTCTCCACAGCTTCACTTGACTTCACTATACCGTCCGTGCCCAGCTCCCGGAATGCCTGCTCGAGCACCTTCTGGAACTCGGGATTCTGCGCGTCCTCG
AGGAACTTGGCCACGTTCTGCCACCGTCTCACAACCATTAGACCATCACTCTGCTTCTCTCAAGCCCCACAACAGCCTCCCTCACCTCCTGCATCTTGTT
GTCTTCGTCGCTCTGCGTGGCGGCGGCAGTGGCGGCCGCTTGTTGCTTCACGCTGGAGATCTCCGAGGCCTGCGCGGCGCTCACCTCGTCCGCAAAGTCG
TCCAGCGCATCTGTCGCAGCGCAGAGAGCACGATTAGTGGGTGGGAGTAGAGAGTGGAGATGCAGGCGGGCGCTCACCGTCCAGGAGGTCGTCCAGATCC
AGCTCCTCCTCGTGGGGCGCGCTCGCGGTCTCCTCCTTGCTGCTCATCGTATCGTGCGGTGATTGGCTTTTTGACGTGAACTCAACAAA