Description :
From Genome Similarity Track
Location :
Scaffold_438:3308- 4522
Sequence
1214 bases(100 bases per row)
CAACGGTGTTGCTCGGTATAGGGCTACTGTAAAGGGGTTACACATCGTAGGGTACTCGGTACCCTGTGTCTTAGACGCATGGGATGGTATCCCATTGAAA
GAGATAGAATATCTTATCCATTTATAGGGGCTGACGGGTATGAGCCACGAGATAGGAAAGATCTCGAAAGTTCTTGGTTTAGGACATGAGTGCCTAGATT
AGGTAATATTAGGATTAAGATATTCTATAGAGGTAAACGTAAATAAAGTTCAGTCCCCCTTTTGATCTTGTCTAAGACACGTGCCTTGCGAGGCGTCTCG
GATCGTTAAGAGTTAGCACATCTCGCTGAGATAGCTACTCTTGAGCATTAAGTGCTGTAGATTCACTGAATCGTTCGGTTCCCTGGAACAGGGACCTTAA
GCGTTACGCTTGTTGACTCATATAGTTTAGTTCTTTGTAACTAATTTTGCTCCTTGAGCACTATGTCTTCCTCTGACTTAAGGAGCTGTGCAGCTCCGCT
ACACTTGGTAGCACTTGTATTCAATCTACGCCTGAGTCTTTAAATACTGATCCTCTGTGAGGATGGAAAACCCCACTCCCCTCTCTGAGGCCCAAAAGGT
CGCGCTTGATAAGCTGACCGCATCTTTGGGTCCAGATTACGTGAAATTCCTTGTATCGCAAGGCCCAGAGGTCCTTACTGCACGTTCTGAGGGCTTCTTG
CAGTATGAAGCGTCCCTTCTAGGACAGGTCCAAGACCAAATGGCGTCGGCTATGCCTACACCCTATGTGTCTGTTCCAGACGAAGATGCTAGGATTCGTC
CACTGAGAGTGGAAGTTAAAAAATACTCAGGAAAGAAGGGTGAAAACCTCATCCTCTGGATCCGTGAGATTGAGATGGCCATGAGATCAGGCCTGATCAA
GCTTGACCATCAACAGGTCTCGCTGGCTATCTCAAAGCTCAATGGAAGAGCTAGAGAACGGGCCTTGACGTGTAGCACGTCGGTCGACTTAGCGTTTCCC
ACATGGGAGTCGCTTAAGTCACAATTGATACAGGTGCTTTCACCACCTAACCAGGCTTACCGCGTGCGTTCACGCTTTTTATCAACCCGTCAGGGTAAGA
ATGAGTTAACGGACTATGTCCAAGAGTTGAAACCTCTCATGGCTGCTATGCAGTCTGACCCTCTGCCTGAGGCAGTCCATGTGACTATATTCATGGAGGG
TCTCCGTACTAGCA