Description :
From Genome Similarity Track
Location :
Scaffold_43:33067- 40022
Transcript NameFunction/comments
Phyca_LT1534571554predicted protein
Phyca_LT1534509207ATP-binding Cassette (ABC) Superfamily
Phyca_LT1534120988AlNc14C514G12014
Phyca_LT1534551594adipose triglyceride lipase

Sequence
6955 bases(100 bases per row)
gtttgatccgcgttggatgggttgtcgtgcttttctttcacgtttttaatgcggcttactcgtgttcactcgcctacatttaccactacctgaaatctcc
taaaatggactactacgtccagttgctgcagatgatgccgcaggagaattacaatgtgattatttgtctctatactggtattggagcggtgaacttgtac
agcgcagtcaagatgtcactttactcgatgtattatcggcggttggtctttggtaagttgacagacctttgcacagaaaatgataccgaagacgataacg
accaagcctcagactggacagcgacactgcactctttaaagcggttcgtagcagggtttgcgcgcgcaaccagtgctcgaggcgagtggtttgatatgat
tttactcttgagcgaagtgtcggagattgcgtcacagactgtccaagcatattcgtccagcttccttattagtagcatttgggtgaaccaagtattcgcg
gggctcatcttcctcaacaccatggcaaatacgctcgttcactataatttgggggagaaagtcgggttgaggcggctaagcagcactgcgattgacctga
tccttgattttacgtgggggttcgtcctccctggcaagatcatctttgtctacatgttgacgttcatgaagtaccatgggtcgttcccagtcgagtttaa
ttactccgatactctactaatccgggcaatactcgaatgcaaccagtttttcatggtcacatggttggatgcggtaactacgacgttgccttatctgaac
atgttatcaggtctacgaagcgtaaagttccttatccagcacgacatgacacttgttcgagttttatcgacaacgaaaatcaaacctatcgggccgacgg
caagtcttgcgaatgctaaaagtgttgttgttaattccagcgcttctccaccagcagtcgaagcaaaaggtgaagggagtcaagttgaagtgaaacgaag
tacctgcggtagaaggatcacagcttgcatcgtggttctgatgcccctgtgtggactatttgtgctgctcacatctatcattgcgtcagggatttttttc
agcgaggaggggtcttgtaagcaaggctgcaagttgcagatgcatccgtggtttacctaccagtgtgcctgctctgtcatggagattaactgctatgaga
gagggattaccgggcgcgagggcgaactccggactattttgcttactctggaacccaaagtgctgaattcgctcattatttcacactgctcggagcttgt
cgtcccagaggaaattcgtcgcttcggaaagttgatggcgcttgagctgtataacgcgacggtggtcgattggccaagctcggcttcattatcactccct
tacgtgtcctctctcacaacgatattcattatacgatctcgactcgcagacgggataccggacggcttgacgtcgaacttgtcccccaacgttgtcgata
ttgagattgtagccactgatttcgggggcccgataccagacgacctcgacgagaagtggccggatgtgggtttgctatacatcgaacactgcgggctgca
agagttcccgaaggccttagcccgtatggctttgagtgacttatcactggcagataacaatatctcgagcgttcctgaaagccttagcaagaattccatg
tacgtcgttctggaccggaatccactcgaggagatccccagtggcttcaaatctatgaccgaaatattctatctcacagtgcagtacacgaatatcacca
ctctaccacattggctccagaccactgaagaattggccttgaactttcgagcgcgaggaactccgtactgcaacgatctacccccgcacagtcccgaggc
aaggttcgcatggtgcaaatacgatgactacagcaacggcgtcttcccacttgccatgagagatgaagtacgagccatgaaataaaggcattcattcctt
tcgcagagtcaacatgcttgtcaaagcatttgtttgccacgcacgtggcgatatcatatgatatgattcaggtcatatcataaatgtccacattttagta
tttatggcttgatatttttatggaacgcaccacaaataattcctgtaaaaattctgattggttggaattttattacgtaaattttaaccctatttatatt
ccaatacgtgagacactccgggttagggtgtgccataagtagcttccaaaaatccaaaaagagccaaaaagcgccatatttagtgttagttgtggggatt
tcaaacccttgcgacatgaaagttgccattttgagatggatggcgtaatctcgctccataatcaaagtccctcagtacctcttgacccgcattctttgcg
caaccttcgttcaacctgcgcgtgcgtcagcgccgctgactcagtggtcacttcccgatctgctaaaccatgtcgctgctccacggccgcagcatcttct
tgcgcggcgtgcggcgtctcgaagctgtgcatcgcgcgcccgcctcaccgcccctgtggtttggccgccgccgtcccgggtcggtcgtgctgcctgcgtt
ctcgacgtcagctctggatgataacaagaagaagacgaagtcgtcgctgcaacagcagacaaagcccaaggcgctcaatgccctcagcgggatgggtctg
gaccgtccgcccgacacggcaaaggagattttgagtttcctcatgggtcacctgtggcccaacgaggactccaaggaggccaaagagatcaagcagaagg
tgctcatctcggccggactcgttgtggccgccaaagcgttgactatccaagtgccattcatctttaaggatctggtgaacaacatgggtgaggtatctac
ggctctggctgggtcacccgagatcactgcgccgctagccatggtgctaggttacggactcgccaagtttggtgccagcgcgtccaacgagctttccaac
gctgtgttcgctactgtggctcaaaaaaccatccgcaaggtggcagtgcgtgtattcaggcaccttcacgctatggacctgaagttccatcttgaccgac
agacgggtgctctctcacgaatcattgatcgtggctcaaggtccattgactttgtgttacgtgccatggcgttccgagtggtgccaacagcgctggagat
tggactggtaagcaccattatggccacgagttttggactgccgtatgcgggtgtgacgctcggtacactaacggcgtacacggcgtttactgtggttgtt
acgcaatggcgcgacgagattcgtcgcgagatgaaccggcgtgagaatgaggctggcgcaaaagttatcgattcgctgatgaactacgagacggtcaagt
actttaacaacgaagaacacgaaactgaacgttacgacgaatcattgaaggggtaccagaaagcggcgctcaagacgcagacgtctctggcaatgctgaa
tgctggacagaacggtatcttcagcgttggtcttacggcaatcatgtacatggcatgcgaaggaatcgctgctggtactctcactgtgggtgatctggtg
cttgtaaacggtctgttgttccagctctccatcccgctgaactttattggtagcatttatcgtgaagtccgccaatccgttacggacatggagtcaatgt
tcaagcttggagctgttacccctgtcatcgtgaacccagatgaaaacctgagtttgaccggaagggagccaaagtctatcgagttccgcgatgttgagtt
cgggtaccgctcggagctcccgattctgcgtaaaacttcgtttaaggtggaagctggtaagcgtgttgctatcgttggtactagtggttctggaaagtct
acggtgcttcgactactctaccgtttctacgacccgcagaacggcactatcctcattgacgggaaggatattcgccaagtgagtctggatgagctgcgcc
aggcgattgctatcgttccgcaggataccgtgctgttcaacgacacgattttctacaatatcaactacggccgccttgacgccaccccggaggaagtgat
gaacgcagctcgtgtttctcagatccaccgttccattgaggcattcccagacggatacaacacgcgcgtgggtgaacgaggcttgaaactttcgggtggt
gagaagcagcgtgtatctatcgctcgtgcgatgctcaaggacgcaccgatcctgcttttcgacgaagcgaccagtgccctcgactcagagactgagtcgg
agattgtgcgcgagtttgcggctatcggggagaaccgcacgtcattgatcattgctcatcgactttcgaccatccaaaacgccgacgagatcatcgtatt
cgacaagggcgaggtgatccagcagggatctcacgaggagctgctgcgcgatgtcgagggcaagtacgccgagatgtgggctcgccagaaccaccacgtt
ctcggcttgcttggcagcagcagtgacagtaaaaacactgtggaaagtgtatagaaagctcgtagagattcctgtcacttcaactctgaagtaaaacgga
gcttttcgtgtgaaaaacttaacgaccaatcaaacgtttcaaaagtataaatagattgcctcaacaacttacgaccatggacagctctagcagcgagagt
tccagctcgttcagctccagcgacgacgagccgctcagtctcagcctcaaacgccccaacgcaatgcctccaccaccccctccacccgattcgcccccgc
ccgaaatgatgccgccgccacctcctcctccgggcccaccgccacctatcgatacaaagcgcaagtcaacgagacctcgacggacgaagaccaacactcc
gacatcaaccaagccagtcaagaaggtgacgcctactccacgtagtaaacgaagctcggcaatggaaaaagcagtcgttagacaggaaaagacgagtcgt
cagaactctccggttaagcagcaatgggctgactcctccacagctgagagtgcattagaggaagatccagacgcgtactctgacgagtcggacgtgtttg
aagaggatgtggaggcaatattattcgctgaagaggaggaagaccgacgtagaggctacactgactgtctaacggaaacacatttggacagcacagagta
cccgtatccagcgtacctcgccaagttgtcgacactgttcacggaacaaagcgttttcgggaagaatcccgaggattttatttattgcaacaacttactg
gtatgctgcggcgggtgttagattgtggacgaagctgacgtttgtttcttacggtaggttaatccaacccagctgaagctcgtagacgcaaggacggctg
cattagagcgggagaagctacagcaagtgcgaaaggctgcagagttaaaggcgaagcaggaaaggaagagaagacgtcaagaaaggtacctaccttgctt
gcatggcactattttcactgacacataatcatgctggatctttcagacttgctgaagcattagaatcgcctgcgaagaaaatcaagatagcagaagccac
tttaaaagctctggagtcgaagcaaacagcattagtgagtagctcgagagcttcttcgagcgccccacgaaagcgaagtcgaaagaagcctgttgcatct
gcatctatgaaatctaccacgccagcttcatcgaatccaccaagcgatgcttccacaagtagtaccaagaagactaaaccgaaggcttcatcagcacagg
tgaaagataaagccgaagttgctgcaattaccaagaaggtcccaaccgctgcaaaacgccgtaccaagaaggccacacctggtgcaacctcggcaactac
taaaactacgactgcaactgcaaaatcccttaagccagtcacgaagacagaagcgaaaagacaaaagcctgcaacttctgttagtaaggccaaggaaatc
aaggtgcaagcagagatcgagaagaaccgcgccgacacgaaggtggatcttgggagcgagagctcgtcgagctcgtcgagctcctcgtcctcttcttctt
cgtcctcttcgtcgtcctcatcttcagtatcttcggtatcgagtagcagtaactcatctgacgctggcacaaaagacaactagtccgcaacatgaagaaa
tacccgagccgaaacgtgaaaaaactaccgtgtttttacattttctcaactttaagtaacctgcttgtcagcccagatacgtgcagacttcttgcccaac
tcgaaaagatcatccagcactacaatctctggtggaaacagagcgaagcgggccaactggagaatcgtgtacgggaagtcaggatcaattgacgggctaa
tctcgtagtcatttcgacgcagaacgtgggcgtggaaggcgcataccttgacataccccgggatttccggcaccaaagtgagcaaacctccgtccacatg
gtactctcctcgaaagaccgacgtgcctcgtttggccaggtaccagggaatataacacgaggcgatgagcgcatcacacaggtcgtctgtcgagtggaag
tcgtcggtcagtattagcgctcgagcaggccacatcttctccgtggcgattgtcagtcgctgcgccagcgtctccaccgggagatcaccgaatttagtgt
ggaaaatggtccgcagtcgctcctcaagcttccacacggtcccttcgctgtgacagagttttgccatggctttagtctctccataaatgtcgctcatgct
cgcgttggctgctaaagtcaatgcggcgatggcgcctccagaagctccagcaaacttggaactcgactgaataaagcctgcatcctgcagcccctgtgcc
acgcctaaatgataagggatcaggaatccgcaaccactgaagctgaagttacgtg