Description :
From Genome Similarity Track
Location :
Scaffold_36:33065- 46426
Transcript NameFunction/comments
Phyag_g928hypothetical protein PHYSODRAFT_309136
Phyag_g929hypothetical protein
Phyag_g930vesicle coat complex COPII subunit SEC13
Phyag_g931hypothetical protein PHYSODRAFT_551952
Phyag_g932hypothetical protein PHYSODRAFT_477864
Phyag_g933hypothetical protein PHYSODRAFT_470700
Phyag_g934hypothetical protein PHYSODRAFT_248463
Phyag_g935conserved hypothetical protein
Phyag_g936hypothetical protein PHYSODRAFT_466632

Sequence
13361 bases(100 bases per row)
CCCAACGGTCCGTTTCCCCCCGTTTTCCTTCTCTattctcttcttctcacACAACTCAAAGGGCCCCAAGAGAACGCGCGCGTCGCTTCCTCCCGTCTCC
ATGTAGGTGCCTCCTTTAGTCGCAATTCCTGGCAGCTGTACACGCTGCTATATCCCTTCCTCCCCCTTCCAGCTCCGCATCTTTCCTGTCTTGCCGGCTG
GTCGAAGCGGCCAGATCGCGAGGATCTTTCTTCGGATTCTGGAGCCCATTTGGAAGGGGGTGAAAGAAGGAGGTATATAATCCATAATGAGGCCTCGCCA
ACTGACTGATCGCTGTGTTTTGCAGCAGATAAGCTCCTTCACCCAACTCTTTCTTCCCACATTTGCCCAAGATGAACCCGGAATAGTATGAGCAGGATAT
GATTTATCGCAGTTGTCCGAAGGCCAGACCAAACTGACAAGCGCCTGTTGTGTGCAGTGACTACctgttcaagctgctgctgatcggTGACTCCGGTGTC
GGAAAgtcgtgtctgctgctccgttTCGCCGACGACACTTACACGGAGAGCTACATCTCGACCATTGGTGTGGACTTTGTGAGTGTCATATCTACCGGCC
CTTTGATTATCAACCAGGGCAGGTTTCAATCAGGATTGCTGACGTTGTGGTAATAACTGTAACTGTGTCCAGAAAATCCGTACGATCGAACTGGACGGCA
AGACCATCAAGCTCCAGATTGTACGTCAGCCATCGTACAAACTTCATGCTCTCGAGTTTTAAACTAACTGTTTGTGCTTCTGTAGTGGGACACGGCCGGT
CAGGAGCGTTTCCGCACGATCACTAGCAGTTATTACCGCGGTGCCCACGGCATTATCGTGGTGTATGACGTGACGGACCAGGAGTCGTTCAACAACGTCA
AGCAGTGGCTGCACGAGATTGATAGGTGCGTCCAGTTCTTCGGGTTTGGCTACTGGGAAGACCATCACTAAAGTGTTGCAATCTACAGATACGCCTGTGA
GAACGTCAACAAGCTGTTGGTCGGTAACAAGAGCGATCTGACGGCCAAGCGTGTGGTGAGCACGGACGCCGCCAAGGAGTTCGCCGAGAGCTTGGGCATT
GAGTTCCTGGAGACCAGTGCGAAGAACGCCGCCAACGTCGAAAAGGCCTTCATGATGATGGCTGCTCAGATCAAGAAGCGCATGGCCAACGCGCCCGTGG
CCCCCAAGGCCGGCGTCAAGCTGACGCCCGGCCAGCAGGTTCCATCCAACGGCGGGTCCAAGTGCTGCTAAGCAGCATCGTTTAGTCCTGTTTGCCTCGC
GTCGCACGGTGGTTGATTTGTCTGCAGTTTAGCTTCGGAGAGCTCGAGAGGCGCGGGTACTGGAGGTCCAGAACAGGATAAAGATCAATATGGCTGCTAT
GCGACGCGGGTGAAAAGGCTGTTCGAGGATTCGGTGGCGTTTGGAAAGGGGTAACAGGTTGCGCTTTCTCAGGTCGGCTCTGTGGCCCTCTCCTCGGTCT
CGCTTTCTCGGTTTTGGCTGAAAGGAGCGACAACGAATGCTACTCTGGTTAGTTGTGACCCTATACATCGTATATTCTTTCTCTTTCTACAAGCGggtgt
tttttttttttgcgttGTGCTCTTGGTTTGTTGATCCATCTGTAAAGGTTGGCTGCAAAGTTCTTCACTtcgatgatggagctggtTGTGAAAACGCAGC
GCGAAGCGAGCCTGCATGGGAATCCTTGTACGCTAGGTATTCGAACTCGGGCTGCCGCTTTTTGGACTTGACCGACTGCAAGAGCCAATCTGCGACGACA
AATAAGCCGCGATTGAGATAGCAGATCTTGCAATGAACAACGAAGAAGTAGAAGCATACCTGGACTCACGAACATGGCCCTACTAGAGCTCTGTGAGGTA
AAAGACGCCCATCAGACCCAACTCATCCACCATAGCCAGCTTCTTACCTTGACCACTTTATCTGCCTTGGACCCGTTCAAGTTGACACCGACCATGTGTG
TGACGCGTGTGGCAGTCATCATAGAGCTGCATTAGGATCAAACAGAGCATTAGAGATAGGTCAATCAAATCTGGCGCGTTGAAGTCTCTAGGCAAAAAAA
AGTCGCAGAGCGTACGCCACGATGCCCCCATGctcctgcaccagcttcGCCAGGTAGTACCTATACAAAGCAGAAGCAAGATGCATCGTCAACAGACAAT
ACACAAGAAATGCTACCACCTCTTGCATGCACGTACGAAGACACCTTGCCAGTTCGCCCATTGAACACAATCCGGCATCCCTGTCGAGGACAGAATACCA
TGTCACGGGTGTTGTactccatctgcagcagccagcaatAGCGTACCTCGAAGATATCggattctgcagcacgccgCTTCGCTTCCTCAttgtctgctgc
agccacgaaGAGCAAACTGTCAATGTTGCAGTTGCTCTTACAAACTCCAGTACGGCACGAACCTTGTTTGCTGCCAACCTTTGCGTGTTTCTCCCGGAAA
AACTGCTCCCGCTTTTTCTCAGCATATCGCCTCctggtctcctcctccgcctctCGCTGCTTGTCGCTCTTTACGCGGCGCTCATTGCGCGACGTCGGTC
CGCTCGGTCCGTTCACTGCAAACATCCCGCTCCAATTTAATTtttgaagttgcctttttcaaAATCATTTTGCTCCGACTATAATTTGGTCAATTAGTCA
AATAGTCCTCGTATCCAGGCACATTTTAAAACAAAAATGGAGTTCCGAGGAGGTATGCAAGGGGCAGGCGGGCAGTTCGCTGCGCCGTACGGCCAGCCTC
AGTCCACTCAGCATCAACCGCGTCAGGCGCCTATGACGAGCATCGACACGGAGCATAACGATATGATCTACGACGTGCAGCTGGACTACTACGGGAAGAG
ATTGGCCACCTGCTCGTCCGACAGGACGTTCCGCGTGTACGACGTGTCGAAGGCCATTGTAGCGAACGGAGACAACGACGAACACTCAGCAGCGAAGGAC
GGACAGGACccccaacagcaacagcagcaacttcacgtGTTGCAGCATGCGGTGCCTCTAACGGACGACTCAGCCGCTCCCATCCATCGTGTGGCTTGGG
CGCACCCGAAGTTCGGTGCGGTGTTGGCTCTGGCTGCCCAAGACGGCAAAGTGTACATCTATcgggaggagctggtgcagcagggAACGGGGGGAGTCGG
CAATGTGACGGAGTGGAGACTGAAACACGTGCACGAGTTCCACTCGCTGGCTGTACTGAGTGTGGCGTGGGCACCGTACGAGTACGGACTGTGTCTGGCC
AGTGCATCCGCTGATGGTCAGGTGTCATTCCTTACTCGTATGCGAGATGGATGGGTCATCTCGTCCAGTTTCCGTAACTCGGACGAGGGCATGGGCTGCA
CGTCTGTGAGTTGGGCGCCGTACAACTCGTTGGGCTCGCAGGGATCCAAAGGACCGATCCAACGTGTGGTCACTGGATCCTGCAATCACGCAGTTACTAT
CTGGCAGTTTGTGACCATCCCTGCGGAAGGTGGAAATGCTGGCAACAGCTACTGGGAAGTTTTGGATACTCCGTTGTACGGACACAACGACTGGGTCCGC
GATGTGGCGTGGGCGCCTAATGTCGGCATCCCTGCTAATGTGATCGCGTCGGGATCGGATGATCATACGGTGCGTGTTTGGACTCAAGACGAGGCTGATG
GCGAGTGGGCGTCTCATGTGGTGCACACGTTCCGTGCGCCGGTATACCGGATAAGCTGGTCGCTTACGGGATCGGTGCTCAgcgtcgccgctggtgatga
tgaagTTACCTTTTGGAAGCAATTGAGCAACCATGAATGGACGCAAATGTCTTCTGTCACTGATCAAGGAGCAGCTATCATTACGAACAACTAGACCACT
TGACAAGCAAGATGTCTTTACGGCTTGGAAGGTAAATACGAGGAACTCTACTGTGCATGCGTTCATCTCGCCGCTCCGCTTTATTTATGCCTGTATCGTT
GTCGTACAAAAGCTTCCTAGACGCATCACGATGAGTGGTAAATGCGCATGGCGTAGGATGCAACGTCAAGCAGCTGAAAGTGCTCACTGGCACCGTCAAC
GAGTCTCTTGTCAGCCTCAGCAATACGCAGAcagatcttggccttctgaACGTCATTAATTTTGTCTAGTGCGAGCACATCGTCATTCAGCTGCCGCAAA
ATCGTAAGCACTGGGTATCCAGCCAACAGGATGCTCTCGAtgtccgtcttcatcttctcgaagctgttggagGCCACAGAGACCCaaaattgctgcagca
gctccggagGAGCAAGACCAGCCACAGCAATGACATCATCTTGCGACAACTCATCATCTCCACAAAGTTGCTTGGCACTTTGCAAGTAGTTGATCGCCTT
ACGCAAGTCTCCGTTCGAgcactcgagcagcgactCCAGCACTGGGTCCGGCACATTCACGTGCTCTTCGGACGCAATAAAACGCACACGAGATGCCATG
GAGACCTTCTCTAATGGAGCAAAGCGGAACTTGGCACACCGCGAGGCCACCGGCTCAATGATGCGACTCACGTAGTTGCAAATGAGGCAGAAACGCGTGA
CCTTGGAGTAGTTTTCCATCATGCGACGCAGCGCCGACTGCGCGTCGCCCGTCATGGAGTCGGCCTCATCCAGCACGATGATCTTGAAGGGTGGCAGGCC
ACTGGCACTGCTGATGGCGCCCTGGGCGAAGCTCTTGACCTTCTCGCGCACCACTTTGATGCCTCGATCGTCAGACGCGTTTAGTTCCAAGAATCGTCCG
TTCTTGCGGAAGTCCGGACCAAAGAGTTGGCGTCCCACCGCCACGATGGTGGACGTCTTTCCGGTGCCTGGAGGTCCATAGAACAGCAAGTGAGGCAGCT
GGCCGTTGGCAATGGACGTCTTCAGCGTGGCCACTACATGCTCCTGATGggagatctcgtccacgttctTGGGGCGACTGAGGAGCAGCATTAAATATGA
GAAACGGGTATGTAACAGCAGGCAATACATGCAGGAAGTTGGTGCACTTACTACTTCTCCACCCAGGGCAGCACAGGCGCCGGGACGTTCGTCTTGGACG
TCGATGTGGTGCTGAACATGAGCAATGATCCGAATGGTTCGCGCCTTGGCAAAGTGTAAACTTGTAACCGTGGTTACTCTGGGTTACGTTGCGTGTCATT
TTTTGCGACTTCAAGAACGTGCGCGTTGTACGCCGCCAGTGGCCTCTTGTGGAAGCTTTGCATCATGTTGTCCAACTAATTCACGAGTACAGAGGAATTA
TATCGCAAGTCGCGCTACCGAACTCGCTTGAGCAGGGAAACGGGCACCTATCTAACTGGGCACTTCGCGCCGTCGACCGAAGCTCGACTCTTGTTCGCCA
CGAGAAACTGCGTCAGTATCGACAAGCGATTTACTTGATCCCGGCTAAGATGACTATCGAAGATGGTGCTTTGGAGGCAATGCAGGAGCTGTATTCACAG
TATCCTGTTTGCATTGACGCAAAATTGGTGGAAGCAGTGTGTGAAATGGCGGATCTATCGGTGCTGAAATGGCTCCACTCGCGCGACTCGTCTTTGCCGT
TCCAGAAGTTCAACTGGAGTGTGAAGAGTTTGTTCTATTACGCCTCCATGAAAGGCCGAGCGGATGTGGTTCGCTGGATGATAAAACTTGTTCCTGATCG
CATCCACTCGATTACCTATGCAGCGCAAGGAGGGCATCTGAATGTGATTAAGTGATTGATGAAACAAATGCAATGAGATAAGCAGGTTAACGCTCCATTC
GCCATTGCCGTTGCTAGAGGTCATCTCGAGACGGCCGAATTTCTGCAGGAGAAACGTACGTCGAGCATCATGGACTTACCTCACGACTTTTCTTTCCACG
AAGATTATGATGTGAGAAGATGACTTTCCTTTCGAACCAACTATTCTTCAGTTGACGCGGCAGCGGCAGGCGGTCATCTTGAAATGGTACGGTGGCTATA
CGTCCAACATTCAAAGCATTTTCCCACTCTCACGATGGATTGCGCTGCGATAGATGGTCATTTGGAGGTTGTGAAATTCTTGCATGACAACCGCCGAGAA
GGGTGCACGAAGCAAGCGATGAACAACGCGGCAGGTAACAACCACTTGGAGGTTgtgaagtggctgcattCTAACAGACGTGAGGGATGTTCAGTCGTGG
CAATGACGAACGCTGCCGCAAACGGACATCTCGAAATGGTACAGTGGTTGCACGCACACTGAAATGAGGGTTGCTCTCCTGCTGCAATGTCCGGAGCTGC
TAGCGGTGGTCATGTTCGAGTGATGGAGTTTCTAGTTCGCGAACTACTCGATTAAATGGGCATCTACGGTGATGAAACACGCTATCGAGCATCACCAAAT
GGCGTccgtcaagtggctgcacTCGCACTTGCAGCCACTCACGTGAAAAGATGGCTCCCATGCAGCCCGCAACGACGACATTGGCGTCCTCGAGTTTATC
CGTACATACGAACGCCGAAGACTGTATCAAACCAACAGTTTCCTTTACTGGTGGTGGCTATGGTGGCAATCGTCAtgtcgaggtggtggtgaaatGGGGT
ACGAAGACCACCCACTCTACGGCAACAACCCACCACGCAAACGTCGAACCGTCAAGCGtcaaggaggaagaagagcgagacTGAAGACTGGGgggaaaaa
aaaaagaggTTAACCCTTATACCTCCAGATAAGCATATTTGGGATCTCTCGCTGCCCGGGGGACTTcctggacagcaacagcgttTTGTATGGAGTTTTT
GTCCAGGAACGTTTTGCCTTTTGCGTTTCTATCTTGGACGAAACTCCATATAAGATGCTGTTTTTGTCCAGAAAATTGGGCATTAGAATAAAATGCGCCG
TTCCGTCAGTATTTCTAATGAGGGGTAATCCTCTGTCTCAGAATATTTCCTCAAAATACGATATTTAAGAATATTCTGAAAGCCTGCTGCGACATTCTGA
TTTAGAGGTAAAAAATACCTGAGCAGCGTCAATCGGTCATTGGCACATTCTAATTCGAAGGGGAACAGTTCTGGTCCGGATCGCCACGTAGCAAATCGAC
ATTATTTCTAGTGCCCGATAGTCATAGCCATGAGCGTCTGCCGcggtgtgctgctgtgcgtggcgacgctgctcgcCTTGCTGCGGTCTTCTCCCGTGCA
GAGCGCACGTCTGGAGCACGTTTCGTTCGAGAAGCCCTTCGACAACATCAACGGGGAAGGCCTGCGTCAGATCGGAGACAACTTTGTGTACGGCGGCGAC
ACAGCTGTGAATCGCCACTTTGCGCGTCTGACGCCCGACCGTCAGAGCAAACGCGGCCACGTGTGGGGCAAGCAGAGGCTGGCGGCCAAGGAGTTCGCGG
CCGTGTTCACGTTCCGCATCAGCGGCCAAGCCAAGAGCTGGTTTGGAGATGGGTTGGCGCTGTGGCTGACCACGAGTCAGTATGTGCAGGGTGACAACCA
CGGCTTCATCGGCGAGTTCAAGGGAATCGGCGTCGTGTTCGACACGTTCATCAACCAGGAGCACAGCGGCGGCCACAAGGACGTGACGTTCTTCGAGAAC
GATGgcaccaagacgctggaccAGCTCAATGACCAGGAGAAGGTCGGCTGCATGGCCCCCGGCATCCGCTACCACGAGAAGAACGCGGCGTTCAGTTCGT
CGCTCAACATGTCCAGAGCCAAAGTCACGTACACGCAGGCGGACCAGCAGTTCACGATCCTGATCGACGCGGATGCTTCGGGTAACTGGGTCAGGTGCTA
CAGTCAGAGACTCACCATTGGTGATGAGTGGATGAACGACGCGTATGTCGGCATCACGGCATCTACTGGAGGACTGGCAGACAACCACGATGTTGTTGCT
TTCAACGTTTACGAGTACGTTCTGGATGCTGTAGGGGTTGGATGTGTCGAGACACTAACTTTTGTGTTTTGGTGTTGTGGAATTTTAGCGACGTGATTGA
CTCGCTGGCTGCCCAGGAGGATGAGAAGCAGCGTAACGCGGTGGACAAGAACCTCGAAGCGACATTGAGCAAGGGCAGTAACGAtgacaagatgaagctg
gtCAAGCGGAAGTACtcgcagttgctggaggagttcgagTACCAGTTCACGGCGTTAAAGGAGTCCACACAGAACACGAtccagaagctgaaggaacaag
gagaggaagacgagaagcGTATTGCTGAGCTTGAGGCCTGGGCAAACGGAAAGGTGGTCGAGCGCGTGCATACCACGGTGAACGCCATCCGCGACCAAGT
AGACTCACAGTTGGAAGAGACCGTGAAGGAAACGGCCGCCAAGTCCAGTAGCTGGAAGACCCCGTTCTTCATCATTGTGATCATCATTGCCGGCATTGTT
GCTGCCGGATACAAGAAGTACCAGGATCTTCGCAAGACGCACTTCCTGTAGGCGAACCACCGCAAGATTTATCCCTGCGTACTTGCATCGGTGATAGACG
CCGTCTGTCAGTCACGTTAGAGACGGCAACTTGCAGATACTGCTAGGAGATGAAATCGCCTGGGGCCAAATGGTAGCTCGCATTCGTGTTTTTTGGACTT
TGTGAACCGGTCTTGACAGCAATGGGGTGGTATGGTACATCTATTGTTCGTGAATACTCTAAAATTTACAGGTTGGTGTACTGCGCGAGGGAGTGATGGT
GTTCATGATGCCAGTTCATCCTGCACATTCTCGCAGATACGACAAACACAGGACGGATCATAGGGAACCTTCCATGGAGAAGGCAGGAAAGCACCATAGC
GGCAGCGCAGCGCGAACCATGGCTTGAAGGCTGGATGATTTGGGTTTATGTTGTCTCGGTGCGCGAGATAGAGCAGTACCACGGGTTCTAGCAGCGGCGG
CTTCACAGTCGCAATTTGGTTGCCTGAGACCACGAACCAGATCGCGTCTACTAGCAGATCTTTCGAGAACTTGTTTGCTCGAgccttgagcagcagcagg
tcagCAAAGTACAGCGCCAGTTGGCGCTGTTCGATTTCGAGGCTTTGGTTGTCTGTAACTTGGAGAGCATACAGTTTCTTCTGCAACACGTCAAGTGTTG
TTGGAGCCATGATCCGGAAGTCAAGAACCCGCAAAAtctcgagctcaagctcgaGAATTTCGTTCCACGTCCACTGCAAAAGCACAGTATTACTTAGCAA
CTACCTCTGTATCTCGACCAAGGTGCATTTCCACTTACGTTGCTGGAGTGCCTCCGTCGCTGCAAAATCTCTTTGATGCTCTTGTCAACAATGGTTGTAG
GCGTCTCGACAAACTTGACGGCAATCCAcaagcacctgcagcaccaagtcaTACACGTCAGCACTCAAATTCAGTAATGACCTTCGCAATGTCTAAAAAT
TCGTACGATATGCTCAGCGCTTCGAGTCTCGCAGCTTCGATACTCTGAAGTTCCATGTATCTATCCAGCAGTCCCACATACAAATGCAGGGTCTCCCGTG
AGAGACCCAGCGCTGACGTGATGGTCAGAATTGCCGCCACCATCTCTTCACGATGGGCTGCAGTCGAATTCTCCTGTTCTTGGTTGTCTGCAACCTCCAA
GTGGTCTACAGACGTGGGCGATTCTGTCCTGACGCGCTTCAattggtcgtcgtcgtcgtcatggatCTGATGGGACGACGAAGGTGGACTTTGTAGCTGT
TCACTGCGCGGTCGTTTGCGGTCGATGCACATGTTCTGCCGAAGACGATTGCTCTCCTTTCCCGCACAGAAACTCTATACAGTGGACATCCACGGAGACA
ATTGACTATATCAAAGGACAAACCCTCAATGCCGGCAAGATGAGAACTGGTGCGTCTACACCGACGAGCTCATTGACGATTTTTGGCGCCGTCGTAACGG
TTTTCCGCGGGTGCTCTGAGCCAATCAAACTCGTGCAAGTTAAGATTCCGCCAATCAGCGAACATCTACTATTTGGTGTAATCCACCCCAGTCACACACG
TTGCGGATATTTTTGGTTGGCAATTGACAGTCGAGTGTATCACCATGGCCGCCACCAAgccgtccaagaagcagcgcggcAAGCTGAAAGCCGCTaagac
caagaaggagacgccCAAGCAGCACGTCAAATTCGACGACAATGGAGACAAAGTGGTGCCCAAGAAACGGGCGCGtgcgttcaagaagaaggatgcagag
gaggtgaaggaagGTGGCGGCAAGTCCGACCGCTCTCCGGAGATGATCCAGCAGGCCAAGTACTACCTAGAGCAATGGCAGAAGCGCGACGAGCCCAAGG
CTGATGACGAGCTGCCGTGGAAGTTCAAGGTTGGGAGATTCGATTAATTTGTTAGCTgggtggtgacgatgaaagGCTGCAGCTTATTTGACTGTCGTGT
GTTCGTGACAATGCAGAAAATCAAACAGCAGTGGATCCTGCAGTGGATGTACGAGGCGGACGTCGTGCCCAAGTCAATGTTCGCCATTGTGCTGGAGTAC
CTCGATGGTATTCAAGGCGCTGCCCGCCAGGTTTGTAGACTCTTTGAAGTTTGATTAAAGAAGTTATTGAACTGATCGGTGTGTGGCTTCTACTTGATGC
AGCGTGTTATGGAGGCGGCGCAGGAGATCATCGATGCTGGCGTTCCAgcgaaagaggaggaagaagcggcagctgaggagaaggaaaagatGCTCAGTAT
TAAGCTTGCTCGACGGCGTTACAAGCGTGCGCTGCAAgttgcggagctgctggcttaACTTCTGTTAGAAACAAAACTTTTCTATGTTTACTGGCCTACT
TCGGTGCTGAAATTCGGTTTCCGTAGCCCTTGCGCAAGGAAGCTAATCAGCGTGACCTCCGATGTGATCCGAAACCATGTCACGGAATCGATCAGCAGAG
CAGAGGCCATCCCGAGACTCACCAATAGCTAGGATGTCACCATTCAGTCGAGCGCGAACAAAGAAATTACCATTTTCGTCTTCGAGGAGTTCCAACGCGA
GAGCCGAGGAGTACTCAGGCCACCAGCCGATGTCATTCGCAATTTCAGCGTCCATGGTTCGGAGGACGGAAAGCAACGAAACGTCATGCCCACTGTAGAT
CACGACTTTCTTGCTTTCGCTGTGTTCCCAGAGACCCTTTTGCATCTGTAGGGACCACGTTGAACGAAGAATATCAGTCACAAACCCAATGGCGCTCCTC
AACCTAAAAACTGCCGCACCTCGCGAAGCACGTTATGCATCAAGCGTCCAGCCACGAGCTTCAGAATTGTTCGATGCGAGTAAAACTAAGCACCACACAC
ACCCATCAACGATAATTCACCGCTAACTGACTGCAGTCATCTCTCGAAGGTTTCCCGTACCTGGTGGAAACGGAAACCGAGGTGTCGTTCGGCAACTTCA
CTGTGTACCTCGGTACCGGGGATGTAAGGGACCTGGTGAGCGCGACGGCAAACGTAATAATCGGCAGCGGTTAACCAAGTGAACGGGACCTGGCCCGAGT
CAACGGCTGGAAAAAGCCTCGTCAACTCCTGCTTAATCGGAGCCATCTCGTGCTCACGTGCAGCAAACTCAGCATTGTCCCGTTCCAAGTCCGCTTTCAT
CTCCATAATCTCTGGGAATACATTGTACGCTGCAAGCATAACCCACACCTGTCAGTTTACAGTCCGTAGCACACAGCAACCGGAACTATCCTTCACAAAA
CTCACTGTTGATGATGTCCTTTTCCGGGGGCAGCACACCCACCGGAGGGCTCAGTTGGGGCTGGTCACGTAACATACctcccagcagcgcctgcacaCTG
AGTTGAGTCCGCGTGTACCCGTTGCTGAAGATCTGCACCTGCTCAGGTGTCACTTCATCGAGTTTCAACTCTTGCTTCTTGCAAAAGTTTCGCTGTCACA
TTCCACATTCGACATACGAGCCCGTTATCCTTCAGCTCCACACCCCCCCAGCATCAAATTTCCTCCCACCAGTCGATCTCCACGCTTTGCCATCTGTTCG
ACGCCTTGCGTCGTCAAATACCCGAATggccgctgctggaacgagttCTGGGCGTCGCCACCCAAATGGACACTGAACTTGGAGCGGAGCTGCGCAAGTT
GCGTCGGGGTTGGCAGCTGACGATCCCagagcagcgtctcctcctcctcggaaCGGGCATTGACACTCCCTTTGAAGATGTTGAGCAATGGGGTGCGGTC
GCCATGGCGATGCACAACCTGCAATTGACGCAAACGTAGCGCCATCGTTGAGTGGGGTGCACCTGATACGCTGACACGTACTTCAGAGttggtgtgcacc
acaccactcGCCGTTTCAAAACCGACCTTGCTGTTGCATAAACCCCTAATTAGATGACCGCTTGTGTCAACTGCGCGCTGTTCGTGCCTGGAGGGTTCTG
CGCATCCCGTCGTCCGCgtgaagatggcgaaggAAGCTGTGGTCGCAGCCTCCACGCTTACTTTGAAAGACGCGCAGCGATGCTTTGACAAGGTGAGGTG
AAGCGATATAGGCGCCTCGTCTCAGGATGTTGAAGTTATATTATGTAGacgaatgtagccattttctGACACTTGTCGTATTGCACAGGAGCGCCGTGCA
TTCTTGGGCGACCTCGAGACAttgcggcagcagcttgtgaAGAAGGaccagagcgctgctcgcgcgGCCGCAGCTGCGAGTGCGCACACGATTCAGCTCA
AGCGTGAAATTGCTACACTGCAAACCGCAATGGCATCTGTAGAAGCTGAACGTACCAAATCTCAAGAGCAATTTGCCCATACAAGCTCATTGCTGGAGAC
AGCGCTAGATCAACGACAGGAAGACCAAACGAAACTTAGTCGGCTTAACGAGAGGCTAcggacgctggagaagaagcatGAGGACACAATAGCATTGGTG
AAGAGCGAGGCAGCTGGCAATGTACGAGTAACCCAGGAAGAGCGTCAGGCGTTACGAGCAAGGGTTGAGCAGTTAAGAAGCAAACTGGAGAGTGAGCGGA
AAGAGTGGGAAAAGGTACACCGCCCAATGGCGGACGAACTGCAGAAATGTAAGACGCGGCTCCAACTTGtcgacaaggagctgcaggatgcgCGTTATCG
TGAACGATCGAGCTTCCAGTTGAAGGAGAAAATGGGAAGCGAAGTTATTGTGTACAAGCGGAAAGTAGCAGATTTGTCCACGGCTTTGCAGGAAGCGCTA
CACAGTAAAACGGAGCTCAAAACCGAACACTCGTTAATGATCAAGCACATGAAGGAAAAATGGCGAGAAGTGTTGCGTGCTCTTCACCACTCTAAAGAAC
AGTTCTGGATGTTACAAGAGGATTACAGCGGGATGTTTCGTGCAAGAGCATGCGTTGAGCA