Description :
From Genome Similarity Track
Location :
scaffold_84:33031- 36009
Transcript NameFunction/comments
Pl_110153structural maintenance of chromosomes protein 5, putative
Pl_110154conserved hypothetical protein
Pl_110155hypothetical protein PHYSODRAFT_300018
Pl_110156NA

Sequence
2978 bases(100 bases per row)
ATCTTCCTTGGCTGGAGCAAAGTCCGCGTCGCTGTACGCGACAAGCTTCAGCGGCTCTCCTGTCTTGCACTCGCCATGCATTCTAAACCGCAGGCTCCTC
GACCCTCCAAATATCTCATGATCCTCTTGTCTAACTTCTAGTCAGCCACAGTCGGTCTGTGCGTGCACCGCGAGCCCTAAAGAACAGGAAATGCTATGTC
CGGTCGCGTGCACCTCATTAACCACAGCAATCTCCCTATTAACGACTAAAACTTGAACACAGTCACCGCGTCGTTGCATCCCGTGACTGGGGGCAACTCT
GTGCTCGGCTCCGCGCATTCATTCCATTCTTCACCAACTGGGGTTCTCACCCCGTGGGCTAGCTCCATCCCGTGTTCCTTAAGCATGTCACTGATGGTCG
CCTCTTGGTCTAGTTCGTATCCGCTCTCGTAGTCATAGTTAATGCGCATGCCGAGACACTTGTGAGCTCGGCCGAGGTCCTTTACAGAGAGCGACCCTAG
CTCTTCAACAAACGCATCTACGACCACCTGCTTGATCCCGGTGACCAACAGGTCATACACATACACCCCAACCACAACGATCAATCCTGCTCTCGTTCTG
AAATACATATATATGTCCACCAAGCTCTGCTTGAAACCGATCTAAACGTGTTTCCTGTAGAGCAGCTTGATCCAGAGCGGCCCGGCCTGGTTCAAACCAT
ACAGCGCCTTGCGTAGCTCCATCATGAGCTCGTCCATGCTTGTGGCCCCCAGCCGGTTCGTCACATCGTCCGAGATCGTCATACCTTATTGGCACGTGAA
TGAAGATGTCCAGCTCAGCTTCCTTCTCCGCTTTTTCGTTCGCGTTTGGCATATCCCCGTGCTTCGCCTTACGCGCAACTTCCTCGCCAGCACTAAAATC
AGCTTGACGCTCGTCATTTCGATGACAGCGGCGAACACGATCCCATAATTGATCCCGAACACCTGTTTATTTCCGCACGCAACAAGACTTACCTTCATCC
TTCTGCATCCTGCTTGGTCTTATATACACACTTTGTGTGCAGCACACGCACCCTTCGTTTAAGACACATTATTTCCCAGGCGTTGTGGGCTTCCAGAGCA
CTCAGCTCCTCCAACATCGCCTTCAACCACTTTTCATTGAAATGGCCACGCATGGCCTCCCTGTAGTTTTTCGGTCCACGTTTATCTCGTCGTCAACCAC
ATCCAGCCCGGTCTCCTCCTGACGTCCGAGCTCCTCCCGTCGGCCGGACCCGTCCGCGCCACTTGCAGGTTGATGTGCTACCGACCTCGTCACGGGTCGT
TCTCGCATCCGGGGCTTCTTCTTCATCTTCTTCGAGTTCTTACCGCACCTCTCCGCGTCTTTCGCGCGCCCAGTCGCCGTCGCATCACTCCCAGTGTCGC
CCGTCTCGGAGAACGATGTATCCTCACTGAAGCTCTCTTCCCCAGCCTCGTCTGAGTCATCACTTAGGCACAAACGCTGAACCTGCTCGTTGTCGAGGAT
TTCAATGTTCTTCATGCTGAGTCGTCACTACTTCCCTGTTCTTCGGCAGGCAGACTCTGCAGCCCTTCGTCTCCTCTCCTATACCCACAATCATATCCGA
TTGAACGCTATGAGAGCAATTTTTGTTTCGCGGGTCACGATACACCATGCACGGTGATCCAAACTCCACGATCTTGCCCAAGTGGGGCGTCTGCTTAGTT
AACATCCCCATTAGCGATGCTCGCCCGGGGTTTGAGTTGGTCGGCGACCAATTCAGAATATACGCGGATCACTGTCTCCACATCTCCCCAGAAGCTTAGA
GGGAGGCCACAGCGAATATCATGCATCGAGTCATCTACCTTGTGGTCCGATGCATTCTTTCAGCCTTTCCGTTGCTTGCTTGATTCCGAGCCTTGCTTCT
CTCTCCGCCAACGCCTGTACGTTTGCAGAATATGTCTACATTTTCATACTCACCGCCCGGGTCCGTTCTTAGGACGTGTATCTTGAAGTCGGAACGCTTC
TCGAAGAAGACGAGAAAGCGTTCGAATTCTTTCGCAGCGGCGTCTTTCGTTCGCGCCAGAAATACCCTACAATAACTGCTCTTGAAATCAACGAAGTTGA
TCATATAGCGATTGTTGAGTCGATCTCTCGGCGTCATGGGACACTTCAAATCCGAACAAATCACACACCCCACCCTATCGATGGAGGAGTGGTTGCCGAT
ATCCTTATCCGACTGTCAGTTTTTGGTCTGCTTCCCTTGCGCGCAAGTCTAACAGTGGACTCGTCTGAGCTCTGCCAGCTCAAACCCCGAGCTCGGATCT
GAGACCAGTCGTTCAATCGTGTCATAGCCAAGGTGGTCCATCCTCTTGTGGAATTTTATCAAGATCCCCTTTTGCATAGTGTCAGACTCGTCGTTCGCTG
TATTGGCCTCCTGCTCGAGCGCTGTCATGATCACGTCGGCTGATACCTCACGCTTCTGCTTCACAGTACCTTGCACTAGCGTCGCAAGCCAACGTCAAAC
GCCACTATCCCGCCGTTCTTGACGGCAACCACGCGTTGTTCGTCTCGCGGCGTCAACACATATCCAACCTGCCGTATGAGATAAGGTTGTGTACTTCGCG
CGCGGCGTAGTACACGTCCGTCAACTTTACCGACTTCGGGACTCCGCACACTGTCACTCGCAGCGTCACAGTTCCATTCTTTGTCGCGTTCAGCGGGTCA
CCGTTGGGCTATAAGCACGCGCCCTCGCGCAACTCGACCTCATCGAGCCACGCTTCATTGTTTCATAAATGCCTGCTTGACCCACCGTCAAGGGTCCACC
CTTCCTTGGTACCAACCGTCCACATCAAGAGTCAGGTCAGGTTCACGTTTTCGGCCTCGGCAGAGCTCTGGACAGGCCGACCGAAGGTGCCCGATTTGAT
TGCACTCATGGCAACGCCGAGTTTATTTGCGTCGATCGCTCACTGATGCGACAACCTCCTCCCTAGTTCCTTGTGTTT