Description :
From Genome Similarity Track
Location :
Scaffold_27:33031- 35944
Transcript NameFunction/comments
Phyra_77830bifunctional polynucleotide phosphatase/kinase putat

Sequence
2913 bases(100 bases per row)
AGAAGGGTTCGCAGAGGTCGTGAAAGTCCAATTTCGAGTCGACAAAACTGTGTCCGACACGCGCCAAGCTCTGCTGCGATCCTATATTTGAAAGCTTGAG
CCTCAGGACAAAGTTCACTATTAATACCAGGGTGTGCTTCCTCTTTGTGATTGCTTCCTGCTACAGAACGGTGAGATATTTTGGGGCTTGCTGATGATAG
CAGGAGCGAGAACATCTTACTTCCGTCTGTCTCACTCGTGCACTCCTTCGTGAGGACAACAGTGGAGAGCGGCGGAAATTTGGGAACGCGGGAGCGTACG
CAATGTCGTCCAAAATCAAGGATGGACTCTTCATGGGCGACATGGACGCTGCCCAAGACGCAGACTTCCTCCAGCTGAACGGGATAATGCACATTGTCAA
TTGCGTACCCCGTCAGGTGCCTAACATTTTCCAACAGAGCCTCGGCCTGTCCTACACCGCCTGTGACCTGGAGGATACACTGCGACGACCCTTTTTCGAT
CTCAAGAACCGTGAATTCACGCACATTATTCAGCTTATCGACCGAGCGCTCGAGCGGACGGAGAGCGTGCTGGTGCACTCGTTGAACGGTATCAACCGCA
GTCCCAGCATAATGATCGGGTACTTGATGGTGAAATACTGTTGGGGTCTCGACAAGGCGCACGAGTTTGTGACGATCAAGCGCTCGGACATGAAGCTGCA
CGAGTCGTACATCGACCAGCTGTGCTCTCTCGAAGCGCAGATTCAAGAAGATCGCCCACAGCGCGCCACCGAGCGTCAGCTGTACGAGTGGAGTACGCAT
GCGGCTGACCCAAAGAGTGACGAATTTGTGCTCATCCACACGTTCCTGAATACCGGTTCGGCGCCTGATGTGAATGATGCAGCTGAACGCGGACGAAATG
AAACGGGCAGGCGTTTACGCGGCTTAGTCCCTGAACGACGACTAACCTGGATCGACCAGACCCCCGAAATGGTATGCCAACCATTCAACGACACCGCACG
CTGACCAAAGTGGCTAACTGAAATTATGTTGTGTTCGTTGTTCAGAGGAAGCTGCATCCCTCGCTGTTGGTCCGGCCGGAGCGTCCGCCCAATCATTCAT
ACAGCAAAATGAGTGCGGTGAGTTCCATGGGCATCACGGATTTTTGTGTATTCGCTCTGCTAACGTACGATGGCGACACTATGCAGGCGAACGGATGGGT
AGACTTACTCGATCCTTCACCGGCACTTGCCCAGCAAGCTAAGATTAAGGTAGATTCTGATGCGTGGCGGGAGCGATGGAGCCAGGGATTCTAATACCTG
CTACCTTTGTTCATGTATTGTAGGAAATGGCAGCGGAAGCTGGCCATCTGGCTACTCGAGTAGCCTTTGCCGATCTCTCATCGTCTGGATTGAGTTCCAA
GCTTGACCCCCGAGTAGCGAGCAGATATCTTGATCAGGGTGAACCAGAGTTTGACATGGCAGGCCCATCGGCTGCAGAAGCGTCGTTGGCACACAACAAC
AAGCGTCTTCACTCTTTTTCGGCTCCTAAGAGAACTGAGGTCCTTGACGATGAGGCATCTACGTCTCCATCGACGGTCAGTGAAGAGCTCGATTTTATGC
CAGAGGACGCTTTGGCGGGCTCCAACCCCCGATACCTTCGCGAGACTCTCGCGTCTATCAACTCGCGGCAGCGTCGTCTATCGAGCACCAGCTCCGCTGC
TTCGTATCGATCCTCGACGACCGCTAGCAAGCGTGTGTCGGTTCCAGCTAATGGGCGCAGCAACAGCTCCGGTGCCATCCTCGGCACAACTGGGTCAAAG
GAGACAAAGGCAACAAGCGCTGCATCGAAAACTGTGGCTAAGAAGGCAGGAAAGAGCGCCACGACGTCAAGTTCACGACCAGCTTCAACGACAGCACAAG
GTCGCGTATTCTTCAGCGTCGACTTCCCGCCACCTCAATCTTCGACGGCATCTCTTTCGAGCCGCAGCCGAGGCGGCCACATCCTTACGGGATCATCTCG
TCGTTCCATGGCTGAGCCGCTGTCACAGCAGCCCCAAACATCCGCCCCGATGCGTCCACGAACGGCACCCCCGCGTAGCCGGAAAGACGTCGAGACGAAG
GACCTACTGCAGAGCAAAAAGGTGGATTTGGGTGGATTCAGTCGGATCACGATCGATCCGAAGTCGCAGTCGTCATACCGCATGCACTCGTCCGTGGACT
ATACAGACGCCGATACCAACCCCGCTACTACCAGCTCAACGTCCCGCGGTGCTCGACGAACTTCAGCTTCCTCCACCACTACCACAGGTTATGGCCGAGC
TAAGACTGCTCGAGCTTCATGGCGGTAGAATCAGCAACAAATGGCAAGATCTAACAAGCAACTCGATGGAAAACCAAAACAGAGACTCGATGATCCACAT
GAACACGACATGCTGTTGATACACGACGTGCGTTATTCCTTTGGTGGTTCGTATCTGTAGATAGCTGTTGGCTGTGAAGAGGCGTAGTCAGGAAGAAGGT
GCAGCATGGGCGCTGGTGCCGTGACTTGCTTCACGTGGGTGCCTTCAGCTCGCGATGAAGGCCACACAGCGTGCTCCAAGGATGATCCTGAGGAAGAGGT
ATGGACTCAAGTGCCTAAAGAGGATCACGGCGCGCTCGGTACTACTTGACGTTTTAACCAAGTTATGGATCTTTGTTCAGGTGTTGCAATCAGCATTTGC
AATTAATGTTGTCATACCAAAGTCTCTCGCCCACGGCATGACCAATCTGAACATTGAGAAAAAAAACTTTTCAATGACGGACCGCTTGGTATTGTCTGCT
CGACCCTCTTACTCAAGTACGGCAAGCTCGAAGCAGATACTACACCAGCTCCCGGTTGTTCTGCTTAAGCGGTTGCTATTGAGGGTTCTAGAGCGAAGAA
ATGAATTATTCCA