Description :
From Genome Similarity Track
Location :
Scaffold_198:33029- 34628
Transcript NameFunction/comments
Phyke_g6501conserved hypothetical protein

Sequence
1599 bases(100 bases per row)
gTCTTCAGCAAGCAGGGTGAGGTGATCGCACTCATTGATCTCGACTGCCCCCAGAAGAACGGGTTCTCGGTTGAGGACGAGCGGACGTTCGTGGAAGTGG
CGCGTTTGATCTCGGAGGCATCAGACTGGGACAACATCAACCTGCCGTACACCCAGCCATAAGGCTTTGATTCTCGTCCAGTTTGCACCGATGGCCACTT
TACAACGAACGGTGCACGGTTCTACTTTCACTTCAGCACTGTATTTTTGCTATGGGTCGCTAGAAATGTTAGACGTAGAGTTAAGCATGTGCACTAGCAC
TGTTTTACCGGTAACGCCATTCATCTGTGCAAACCTTTGTGGGGGCCCTCCTGCCGCTGTTTCCTCCATTGGCACGATGTTTGGTGACAGGTGACAATTT
TGCCTCGTATGGATTTATGCTATGGTCTGACGCAGAGCGGTCTAAACTGCGTGTTGTCTGACCGCTGCGTTTGGGCTCGCTTCGTATTCCATTCTGGTTT
TGCTGCCGCAGCAACGACTGCCGGCCTTTGCGCATGACGTGTATTACATCGTAGACAGACGAAGAACCCAATTCTGGTTCAACCGATCCGGCACGCTCCA
GTGCTGCGTGGAAGTCGTTGCCAGACAAGGATGTTGATGGTGTGAGCCTCCGACCAACGAgcttctcttcgtccttTCGCCGGCGTTGCAGaatctgcag
cttcttctgaCTCAAGAGCAAAATGAGATCGAGATCTCGTGTGTGTATGTCActctgaagctgttgtgcGGCACGTAATTGTCCGTTAGCGCCTAGTTCG
AAAGCAAAGCGATCAGCTGTACCATCACAAACGTACCTCTTCCACGTCAAAAAATCCGTGCTGAAGAAAGGAATCCTCGACACCTGGATACACCGCTGAA
CACGGTCAATGCAAAAGATTCTGTCAAGCAAGCACTCATTCTACAGCACTGAAAAACGTACTCAgttggagaagttgctggagctctccTGTGACGAAGA
GCTCAGTGCTCAAAATCTTTTCGGAAATGGCAACCAGATGCTGTAATTCGTGATGAGAGCTCTCTACCTCTGCTACCAAAGCGTTGTTGTTTACATATTG
CTCCGTCTTATCCGAATCCGCTGCTCCAGATATCCATAGCTTCTCGTACGCGCAGTTGGATGCAGAACCGTTTACATGTTCGAAGAATGCCTCGATGGAG
TGCACCAGATGCCTCGACGATAGTTCCTAGAATTCAAGAGCAAACGCTGAGCACATGCCACTGGAACAGGTAGAGTCGCACCTACCTCCAAGAGCTGGCT
AGAGGTTTTAATTACGCTCTTCGCCCTCTCGACAATTGAGccaccttcagctgcaagGAATACTTCTCCCATACGACGCTCATTTGGCACATATTGTAGT
GAGTCGTCAATTTCGAGAGTGCGCTGTTTGGAGATTTTGGTTAGTTTTTTTTCAGGCACGACAAAAGATGAAGGTCGAAAGGCGACAAGTCCATCAAGTG
TGGAAAGCACGGACCTGGGTTGCTGAATGCCACTGGCAAAGATTCGTGCTGGCGCTCAACGTTGAGCTCTCGAGCGTTGCACGGGAAGCGAGACAGGAA