Description :
From Genome Similarity Track
Location :
contig_34:330246- 331698
Transcript NameFunction/comments
g7833.t1hypothetical protein

Sequence
1452 bases(100 bases per row)
CGGCCGCCGCTACGGCCTCGTGGGCAAGAACGGCGCCGGCAAGACGACGCTGCTGCGCTACATGTCGCACTACGAGCTCGAGGGCTTCCCGAGGCACTTG
CGGCTGCAGCTCGTGGAGCAGGAGTCGGCCTCGAAGCTCAGCAAAGACGAGCGCAGCGTGCTGGCCGTGGTGCTGGCCGCTGACTACGAGCGCCAGATGC
TGCTCGACGAGGAGAAGGAGCTCTCAGCGACACGGGAGGAGACCACAGCGCCAGACTCAAGGAGATCTACGACCGACTCAGGGACATTGACGCCGACACG
GCCGAGAGCAGAGCGCGCACGATCCTCAGCGGCCTGCAGTTCCCCGACCACGTCGTGGACGGACCTGCCAAGGCGCTGTCCGGTGGCTGGAGAATGCGCA
CGGCGCTGGCCGGCGCGCTGTTCATGGCGCCCGACCTGCTGCTGCTGGACGAGCCCACGAACCACTTGGACCTGGAAGCCGTGATCTGGCTCGAGCACTA
CCTGGAGAAGTACGACAAGCAGATGATCGTGGTCTCGCACGACCGCAACTTTTTGAACGCCGTGACCACCGACATGATCCACCTGACGCAGCAGAAGCTC
ATGTACTACAAGGGCGATTACAACACGTTCGAGCACACGATGAAGGAGAACCTGCGCCAGCAGCGCAAGGCCTACGACGCCCAGCAGATGAGGATCCAAC
ACATGCAGGAGTTCATCGAGCGCTTCCGCGCCAACGCCAAGAAGGCGCCGCTGGTGCAGTCGCGCGTCAAGGCGCTGGACAAGATCCTGCGCAACGAGCT
CGTCGACGAGCCCGAGGACGAGCACGCCTTCCGGATGCACTTCCCGCCCCCGGAGCCGCTGGGCCGGCCGATTATCGCGGTCGAAGACGTGGGCTTCCGG
TACACGCCGGAGTCGCCCCTGCTGTTCAAAGACGTGCACATTGGCGTGGACATGTCCAGTCGTATTGGTATCCTCGGTGTCAACGGTTCGGGTAAGTCGA
CGCTCATTAACATCATGATTGGCAAGCTGCGCGCGACGGAGGGTTCCGTCACGATGAACCCGCGGCTGCGCGTGGCTACGTTCACGCAGCACCACGTCGA
CTCGCTCGACCTGTCCAAGTCTGCTGTGCAGAATATGAAGGAGATGTTCCCTGGACACGAGCCCGACGAGTTCCGTTCGCACCTCGGCCGCTTCAACCTG
TCGGGCGAGCTGGCTATTAAGCCCACGCGAACCCTTTCTGGTGGTCAGAAGTCGCGTGTCGGCTTTGCGATCATGACGTGGCGTCTGCCGCACGTCGTGG
TGCTCGATGAGCCTACGAATCACTTGGATATGGAGACGATCGATGCGCTGATTGATGCCCTGCGTGAGTACAAGGGTGGAGTCGTGATTGTGTCCCACGA
CCAGCACTTCGTCACCAGCGTGTGCGAAGAGCTGTGGGTCGTGGGCGACGAG