Description :
From Genome Similarity Track
Location :
Scaffold_57:33021- 40677
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G014032Similar to Cysteine proteinase COT44 (Fragment) (Brassica napus)
Pytul_DAOMBR144PYU1_G014031Similar to fahd2: Fumarylacetoacetate hydrolase domain-containing protein 2 (Xenopus laevis)
Pytul_DAOMBR144PYU1_G014030Protein of unknown function
Pytul_DAOMBR144PYU1_G014029Similar to cdc18: Cell division control protein 18 (Schizosaccharomyces pombe)
Pytul_DAOMBR144PYU1_G014028Similar to HSFA2B: Heat stress transcription factor A-2b (Oryza sativa subsp. japonica)

Sequence
7656 bases(100 bases per row)
TTTTGCTTGGTGAGGAAGAAGCGCTGCAGGTGGTCTTCCTGCTCTTCGTCAGCACTGCGGGCCTCGCTCACGGGGATCCACCCGTTCACGCTTGCGCTGT
CCTTGAACTTGTTCATCCACGCCTCATACTCGACTTGCATGTCGGCGCGCTCCTCGAGGTAGCGGTGGTAGTGCGGCTCGATGGCCGCGTGCATGGGGCG
CGCGTGCACGTTTGCGCTTGCCACGAGGGCCAAGGCAGCGACGATCGTGAGCAGGTGCATCTTGGGCGTCGAGTGGTGTTTTTCTGCTCGGTATGCTGTG
CGGCTTGTGCTGTCGGAGGCAAATTGGAGAATGAGCGATGGCACCGGGTGGTTGTTATTTCTTGTTTGTTTTGAAAAAAAGACGAGCAAGCAGGAATCAC
GAGGCCAACTCGATGAGCCAAATACTGTAGTTTGCGGTGAACGACTGCAGGACTTGGGTTTGCCATAGCATATCTTGCGTTACGCATTGCAAATGCAAAT
GCAAATGCAAATGCAAGTGGGGGATTAGGCACCCAGCGCTTGCTTTTCGTTCACCACAGGTGTTGCTCTTCAACAACTGCTGCGTAACGAACCGCATCAG
GTCTGATAGCTGCTTGCAGACAAGTTGCTGAAGGAGGAGCTTGCAAAGGCGTTCTGACAACGGCGATTGTTGAGCTTCAACAGATAGTACGTGAGAGCGG
CATCAGAAATACCCGCATCCCAAAGGAAACAACTGGTTCGTCTGAAAGGATTGGTTGTCACTCGTAATACTGACAGGACACGATGTCTACAACATTCCAC
ACGGTGATGTACCCGTAAACTGGACCAAGATGCAAGTGTCCATTGTAATCGGTAGGACAACTTCATCGATGCAAGATATGCGCCTTGAAAGCAGTCGGTT
CTCACGCTTCAGTATCTAAAACAGGCAACGAGAGGTTGCAGCTCTATCTCGTGTCTCCCTTGGCACAAACAAAACGCAATAGAAGCATGAGGGAAGCAGA
CTGGGAGTAATGCGTGCCTCATCATCCTGTGCGAATTTGGGAACGGCGAGTTGTCAGGATTGCAGCAGCAAAAAACACGTCTTCGCTGATTGAATATGGC
GTCAACAGTGCTGAATACATGTATCTTTGTGAAAGTGGCAAATTGTATTCGGTCCGCAATATCCGGCCGAGGATGAGCCAATGAATAACTCTACAGTATT
CTTGACAGGATGACTTACACGTCAACGACAAATGACCGGCTGATCAGGCGACGAGAGAGGTAGGCACCAAACATTCAAACTACAAGTATCGCGGTGAACT
AAGTTAGCTGAGCGAACTGAACGACTGTATGTCGAAGTTGCGGTGTTGTGGTATCGGCAGCTCGGCGACGAAGTGGCTTCGTTTTCAGGTACTTTGCAGT
CGCTTGCTGAAGATTCATACAAGTCCAAGTGTGGCATCAGTGAACCAGATCCTGGCAATATACTTGGCGACTTGTAGATTTAATTAGGCAACATTGCTGA
TATATTTTGTTTCAGCGCAAAATGGAAGTGAACGCGTGACTCCGATACAGGACAAGATTTCTGTCAACTCCCCAATCTTCATTGTGTGCGATTGCTTCTC
ACTACACGTTGAAACTCAAACCACACGTTGGAAAGTGAAACCCAAGTATCATGCGTATACTTTCATTCACAAGTAATCTTTAGGGGTCGTATAAAATACG
ACAGCGCGCACCAAGCAACCTGTAACATCAGAGACAGGCGTCTTCTTGGAATCTCGTCTTCAAATCCGCAACTTGTCGTCAAGCTAAGACTTTTTTTCTA
AGCTCTAAACCGGTAATAGTGGAGGCTTCCTCCTGTACTTCGTTATCCCCCACTTTCAGTGTTTTTGTCCATCCAGTTACCGCTCACGTGTTGCTGCTCT
GCGTGTAGGTGGAGCTCGATCATTATGATCTCGTTGTTGCTCATAAGAAGTAATCCAAATGGCCTCGGTGTTGAGTATTTTAGCGGAAAGCGTACTTTAC
TAACCTAATCAAGCCAAAAAGCGCACTTTGCGAGCGCACTTAGCAAACTTGAGGTTAAAAGCCACTCTCGCTCATTTTCCAACAACACGCATCCTGTGCA
TGCTGCTGCGCCGCTCTTCTCTGCTGTCGCTCCGCCGCTCTGCCCCCCGCACGAGCCCCATGAGCACATCCACTGCCGCCAGAGCCACTGCGGTCGTTCG
CTTCATCGACACCAGCGGCTCCATCCGCTGCGGGCAGCGCGAAGCCACCACGAGCGACTCGGTGCGCCTCGTCGAGCACGACGATCCGCTCGGCAGTCTC
AAGTTCACGGGCGAGCGCGCGACGATCAAGAAGCTGCTGACGCCTGTGGAGCCGTCGCAGATCCTTTGCATCGGCCTCAACTACCGCAAGCACGCGCAGG
AAACCAACATGCCCGAGCCAAAGCACCCGGTGCTCTTCTCCAAGGGCTTGAACACGCTGCAGGACCCAAACGAGCCTGTGGTGATCCCGCGCATCGCGTC
GAGCCCACCAGAGGTCGACTACGAATGCGAACTCGCCGTCGTGCTCAAGGAGACCATCAAGAACGTCAGTGTGGAGGATGCGCTCAAGTACGTGGGCGGA
TACACGTGCGCCAACGACATCTCGGCGCGTCGGTGGCAGGGCGCCAGAGGCGGCAACCAGTGGGTGCGCGCGAAGACGTTCGACACGTTCTGTCCGATTG
GGCCTGTGCTCGTGACCCCGGAAGTCATCCCAGACCCGCAGAAGCTGCGTATCGCGACGTACCTCAATGGCGAGTGCATGCAGAACTCATCGACGGGAGA
CATGATCTTCTCGGTGGCCGAGCTCATCAGCCAGCTCTCACAGGACATCACGCTGCCAAAGGGCACGCTCATCTTGACGGGAACACCGGAAGGCGTGGGC
TTCACGCGCAAACCCGCCGTGTTCCTCGCACCGGGCGACGTCGTCGAGATCGACATTGAGAGCATCGGACGCCTCGTGAACCCAGTGATTGCGGCGTCAG
CGCTGTAAATGTGTTGGCCGCAAAAATAGCAGCTGAGCGTAGCTGGAGAAAAAGAAATTGGTAGTTTTGGTCATAACCGAAAAAGATGAAAACAAACTCT
GCGTTGCGAGGCATAGAACACGTTTTTGCTGTGATTACCGAGATGACAATGCTGCTGCCACAATAATCTGCAACTGGTGAAGGTGTGTGTGTCTTTTTTT
TTCAAATGAAGCTTTTTCAAGTCGAATGCTGCAAAAGAAAGCACAGGACTTTGTAGTCGCAAAGACTGAAGAACAAATGGCTTGAAAGGGTGCAAATCGA
GATTTGGAGTCTGAATCCCGATTATCTTAACCACCATGAATCTTTGGCTCACAAAGTGACAAAACAGGCAATCTTCATAATGGGTAAATTGCTCTACTGT
ACGGATGAGCCACGGTATCCTGGCCAATCAGCGTCTCCGTCCGTTACTCTTTTAGCCAATCACATGGCTGAATATGCGACACATGGTGGAATCAATCCAG
TCAGATGTGTCTCTCTCTTCTAGCCACGCGTGACTCGCAATGCGTCAACAGCTTGTTTATCAGACAAGCGAATGAATGGCGGCCCCCCATGGCCCAACGA
CGCATGCGGCTCACTCGCCATCCCGCTCCTCCAGCAGCTCGCTCTATCAGCCTCGCTCTTCGTCTTGGGGAATGGCCTGTTAAACAACCAGAACTCAAGC
CGCCCGAGTGAGTCCCTTCCATAATCGGACTTCGTGTCTCCAGCACATTGCGCGTGTCTCTCTCGTCGGAGCGTCTGGCGACAGAGTCAAGCGCCGCAAG
CAGGTCACCTCTGGTTTAACGTGTCTCGTGCAACCCGCTGCCCGGAGTAACTGAATTGCCATTTTTGGCTACAAAAACCTCTGTAGCGACGCAAAGACAA
GAGCAAATCGGCAGCAGGTGACACGCGACGCTCTACAGTGTAATACAATACTGCAGCATGGCATATCCTCCGCCAGACGCGCGCAATGGCGCTAACATGT
CGGCCATTTTTCGAATCACGATCCAGCGCGTACGAGCCATGATGTCCACTGCGGCGTTCTCGAGACGATTCATCGGCGCGTCGGCGCTCGCCATGTACGC
GTTCTCGTCCTACCCGATCGCTGAGCCAACCAGCGATTTCTCGTTGAGTCTGGCCCAGGGCTCCGATTCTGTTGAACTCGACCGTCGAGATCCGTTTGCG
ATCAACGTCCGCAACGTTGCGGCGCATGTTGGCGTCAAGAACCCTGAGAGACTGTCGATTCGCGTGGGCGAAGAGACTGCGGGCGCGTCCATGGGCGCGA
ATGTGACGATTGGGCGCCGTGGCGCGTGCATCATCCTCCCCGTGGAGCTCTACGAAGCCTTCCACGCGACGCCTGCGATACGCAAGAAGTACGATCTCCC
GGGCAAGGACGAGATCAACTTTGTGCTCGCTCATGAGAGCGCGCACATCGCCAAGAACCACTCGGTCATCTCGGGCACCTTTCTGCCTCTGTCGATGGTG
ACGTGCTGCTACCTGATCAAGAAGATCCCGAACAAGGTGCTCGCGTCAGCATTCGGGTGCCTCGCGCTTGTCGGCGGCAACACGTTCCTCTCGTGGCGCA
TCGAGCACGAAGCCGACCACGTCGCAGCCGAACGTGGGTATGCGCACGGCGGCATCAACTGCTTCGAGCGCAAACTGTCACGTAACTGCGAGCTGCGCAC
GTTGCTCAACACGCACATGATCACGAAGCAGGGCAACTATCTGGGGGACACGGCGCACCCATTGCTTACATCGCGGATTCACCACCTCAAGCTCATCGCC
GACGCCAGAGCCAGCGACGCGACGTCCGCACTGCACGCTCACTCTGGCTGCAAGTACTGCCTTCGAGTATAACGAGAAGCCTTCATCCCGGGCATCCGAC
AGAGAGAGAGCGAACTATTCACCACGGTTTTGTATTTTTCGAGCAGCCAACACCACAGAAGAACTCATTTAGCCTGTATTCTCATATTTAATAGAGCATG
TAACCATCCAAGTACTGATATCTGTTAGCTTCAGATATAGGAGCTCAAGGTGCATGTTTGAGCCCTTAGTCATCCTCTCTTAAAACCAAAAACGGAACCG
GTTTTAATGAGGAGGGTCCATGGCAGTTGGCGTGAGAACTCGGAGACCCTGGCCGCTGATTGGTTGATTGTTTTGGCGCGCTCCCGGCCGTTCACCCTTC
GCGCGCTGAACATGCTGCTGCAGGTCACACAGTAAAGTGCCTCGCGCTGCGCACCCCAACGTCTCTCTATTATCTCTCTCTGTGTATTTGTACAAGCATG
CGCACGCGTTCGCAGATCAGCGCATGGGCCCAGGCGCAACAGCAGTACCTCAGCGGCGACGCAGTCGCGGTGTCAGCGCCGCAGCCAAAGACGCACCCGA
AGAAGCGCAAGCTGCGCGTGGCAGTGGCACAAACAGACACTCCAGGCATGCATGACACCGCAGTGTTAACAGATTTGGCTGCGACCAAGAAGGCGATTCT
GGATTATATCTCGCCGAACGCAAAGAAGGCGAAGTTGCACGCGGAACAGCAAGATACAGCAAAGCATGAGCAGCAGATGCATGGCTTGGTTTTGTTCAAG
ACCCCGATGAAGAGACCGATGCTGACGGTGGATACCCAGCCAGCGCCAGTGAAAGACGACGAGGCAGCAAAAGCGCAATCGATTCTGGATTACATCTCTC
CAAACTCGAAGCAGAGCAAGCTGAACACGCAGAAGATAGCACCAGCGAGTGGTTTAACTCCAGAAGCGTCCCGCAAGCGCCCGCACATTCGACGCTCGCT
CACGTACGCATCGAGCGACTGCGTGCTTTCAGACTCGAGCGTTGAAGACCGTACGCCTCAAAGGCTCAGCCCAGCGTCCTCTCCACGAACGAATGACCGA
GCGTCCATGCTTCAGCGCATTGCTGGCTCTTGCGCGGCGCAGAAGCAGCTCCCCGTCGTGGGTCGAACCGCAGAGAAAGATATGATTGCGTCCGTTCTGT
ATGACGACAATGACCCACAGCAGCAAAGAAAGCGAAGCATCTTCATCGTCGGACCTCCGGGCACGGGCAAATCGTCCTCGGTCAAGGAGCTGCTCAGCGA
CTACGAGCGCCGTTGCCCCAGGAATGCCGTCATCCGACTCAACTGCAGTACGTACACCAACCCGACGGCGCTGTACGCGGAGTTGGACGCCCAGCTTCGT
GTCCACTCGCCATGGATGCTCCCGTATCTGGACCCGTACCTCCTCGACGAGTTCCTGCAAGATGTGGCCGCGAGAAAGCCAACCAAGAGTGAAAGTGTCT
TGGTGCTCGATGAGCTCGACCAGTTGCTACGCATGCCGCCTGCGATGCAGAAGCGCGTGCAAGAAGTGTTGCGCTTCCTGGTCGCGTGGTCGGAGCTGCC
GGCGTCGACGTTCACGTTTCTCGGCATCATGAACGGCGTTGACATGCACACGCAAATCTCGAGCTTCCTCCCAAAAGACCACACGGTGTCGCATGTGCTC
TTCCCAGCGTACACGTACAACGACTTGCTAGCGATTCTCAACGCGTACGTCGAGAGCGCGTTTGCTGCTGCTGATGGTCGCGAGATGAACAAACTCATCG
AGCAGCGCGCCATCGAACTGATCGCGCGCAAAGTCGCGTCGCGCGACGGCGACGTGCGTCGTGCCATCAGTTTACTGCAGCAATGCGCTCGCTTCAGCCT
GCGCCGTAGCACTGAAGCCGCTGCCGGCAACATTGCCGATCGATTTGCCGATGAGCACCTCAAGATCACGCTTCGCGACGTGCTCGCGTGCTCGAGCGCG
GCATTAACAGCGGGTCCCGCCCGCGACGTGTACCAGCTGCCTCGCTTGCCCAAGATCCTGTTGTACGTGATCACATCAATCGCGCTGAGCGACGGCAGCA
AAGCTTGCGATATGACGCGCGTGAGTCAAGAACTCGCGCATCTGCGCGCGACGCCGGCGTTCGCGTGGATGCCGCTCTTCAAGCGCGACGACCTGCAGGC
ACACCTGGCGTCGCTCGAGTGCTACGCGCTCGTCAAGCGACCCGCGCGCGCGTCTACGAAGCTCAGCTTCTGGAAAGCCAAGCTGACGTCGGCCGTGACG
ATGGACATCGTCCTTCGAGCCATGCAGGACGATCCGTTGCTCTGTATGCTCGCGCAGCAACACAAGTAGTAAATTAATTTGACATTGTGTACAGAGCATT
TTAATCGCGTTTTATCAAATTTTAACGTTAACCAAGTTCAGATAATAGGGCATGCATTGGAGGGGCTGGAGTTCCGTTGTTGTCTATCGCTGGGAGCCGC
CGACGGCATGCGGCGTCGGCGACGTCTCGACGCGCATCTGGTGCTCCAGCGCGGCCTGCGCCTTCTGCACGAGCAGCGCTAGCAGCGAGCGGTTCAGCGA
TTTCTTCACATGCGGCGGGATCCGCTTCTCAACCGAGTCCTGCACGGCGCGCGGAAGCTCTCGCGAGATGAACTTGAGGATCTCAACGCGGTACATGCAC
GCGGCCTCCGAGTGCCCCTGTTGCGCTCGTCCAAGTGTGGGGGAGCTTGGTTCCTGGACACGAGCGAGGAGTTGCTGAATGTCCGACACGACGGCGTCGG
CGACGGCATCGACCTCGCCTGGCGCGTGGTTCTGCTGAATGCGGATGAAGCCCAGG