Description :
From Genome Similarity Track
Location :
Scaffold_501:3302- 9059
Transcript NameFunction/comments
Physo_125935hypothetical protein
Physo_145120reverse transcriptase

Sequence
5757 bases(100 bases per row)
ANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNTCCGATCGACGAGGCGACCACGTTCATGAAGGGGCTGAGAGATTGGCCTGTGAAGACCTATCTCTTCCGTGAGTACCCGAGTACTCTCG
AAGCTGCAATTACTCTTGCAATGCAGGAGGAGTTTAGCCTGCGGCAGGCTAAGCTGCATGCACATATGCCGAGGCCACAGCCACGCCCGGTAGTGAGGAC
GGGAGGCCCAGAACCCATGGACCTCTCGAGTGCTGCAACTGCTGGACCCCAGCAGTCGCAGGGAAACAATGTGCGATGCTACCGTTGCGGTAGAGTCGGT
CACTTTGCTCGGGAGTGCACGGCCCCCGTGCACCAGCAGGGTGGCTATCGCGGCGGTGCCCGGCACCGTCGCAACCAAACAAAAAATGCTGGACGCCAGT
AGGCGCGGGGCGCCCTACTGGTAATGCAGTTCCGCGTGTCGACCTTGGATACGCGACACTGAGGACTGCAGCCCCCAGTGAGGTTCATCCTCACTGCAAG
AACCAAGATGACAAGCCTGACCTTGTCATCCTGAATGTGAACTCGATGAGAGCAAGCAGCTCTCTCCGTGCTTTGGTAGATTCTGGCGCGTCGAAGAACT
TTGTTCGACTGCGAAGTCTATCAAGGCTTGACTTCGAGGATTTAAAGATACCTCGAAGTATGTTGGAAGTGCGATTGGCAAAGGGTGCCGTCGTGAAGAC
CGAGAAGCGCATGGTACGCGTGCGCTTCACGTATGAAGATCAAGAGTTTGTCGAGACCTTTATCGTCCTGGATCTGGACGATAAGTTTGACATTGTATTG
GGCATGCCGTGGCTTGCACGGCATGATCCGGTCATCGATTGGGAGAAGCGCACTCTCGTGCGCTTCGGTCGCGACAGCGGAACAGTGAGCGATGGCCCTG
TTGCCGCTACGCACGCACCGACAGGTGCGCGCGACTCCCCACTCGAGACAGCGCCTAATGCCGCTGTCCCGGAGCGCCCTGGGCGCGCAAGAGCACGCGC
GCAAGAGCAGCTAGCGTCGGCGTTGCCGCCGACAGCTAATGAAGGAAATGTGTTGACCTCGGAGGTCGACACCCGCTTTTCAGCGAATCANGAAGAGTCT
CCAGCCTCAAGGGGCACGGATGACGCAGGCGAGTCACACGCCTCAGCCGTGGAGGCTGACGCGAATCTGATTGGATCAGGTCTGGCCATAATAAGAGCCA
AGGTGATGAAACGCCGTCGACTCCGGGAGTCGATGGCTTGGGTGAATTTGATTCGTCGGCTCGGGGAGCCGACGCACCCTCCGTAATGGAGGGCTCCACC
AATGACAGGCGTCGAGGTAAAGATGGCGTGTCGACTCCGGGAGTCGACGCTGTAAGCGGTGCGGACGGTTGCAAACGTTCCGCACCGGAAAAACTTGCAT
GCTGTCGTGCAGCCGGGCTGCACGACGAAGCGCCGGGCGACCAAGCCGGGCTTGAAGTCGCTCGCCCGCGGGACGAACCCGCCGGCGGTACTGAAGAAGA
ACACCCGTCCACGGCTGGGCCTGGACGAGGTCAAGAACCAAGCGGAGCCGGGCTCCGCAAAACAAGAAGACGGCGCATGCGAAAGTCGCTGCGCAAGTCT
CGCCCTGGGCCGAGACGCTACAAGGAATGTCTCCCGGGCAGACGGAGGCAGAGAAGCCGGACGTCGAGACGTTGAACATCTTGACGCGTACCTGTGCCGG
GTTCCGGTACAGGGAGATGACTCTCGCTAACCCTCCGACGCAAGCGTCGGAGTTGACTTCGCTTCCAGTCATGAGCTGGAAGCGCTTCGCGGGTGACTTG
CACGATGGACGCATCGATCAAATATGCATTCTCTCGGACGCCGAGAGAACGAAGAGCGAGAATGAAGAACTGAGCCAGTTCTTCATGGAGACCCGAGGAC
ACTCTCAGTGCGAAGACGAAGAAGGAGCGCTTTGAAGAGCAGAGCTGGGACTCGTTTTCAACGAGTCCCTACTACGAGATCTTACGGGAGTACGCGGACG
TACTTCCGGAAGAGATTCCTGCGGAGCTTCCGCAGGACAAGGGCATCCAGCACGAGATTGATCTCGTGCCGGGGACGAAGTACTGTGTCACGCGGCAGTG
GCCACTGCCGCGAGAGCAGGTCAAGGCGATCGACGGCTTCTTTGAGAGTCGTCGCAAAGCTGGACAAGTGCGGGAATCGAAATCCCCGCACAGTGCTCCG
ACGTTCTGTGTCAAGAAGCCACAGGGCGGTTGGCGCATCGTTCATGCGTACAACAAGCTGAACGATGCGACGATTCCGGCGCAGACACCGATACCGCGAA
AAGATGTCATCATCGATTCGATGGCCAGGAGCACTATCTACAGTGCTCTTGATCTGCGCGATGGGTTCTATCAGATCCTCATGCGTGAGAGCGATATCCC
TCTCACGGCCGTGAGCACGCCGAGCGGCATGGTCTGGGAGTGGCTAGTGATGCCGCTGGGTCTGAAGAACGCCCCTGCGACCTTCAACAGGTGCGTGACG
CACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTACTTCGACGATGTGTTCGTCCACAGCCGGGCTGCGGACGGGATGAGCGATGTTGAGATGCACA
AGGTGCATCTCCGGAAGCCGCTTGCGCTCATGCGCAAGCACAAGCTCTATGCGAACCTGAAGAAGTACATCTTCGGGGCGAGCGAGATACCCGTGCTCGG
GTGTCTCGTTGGGAAGAACGGTGTCCGCCCTGACCCTGAGAAGGTCAGAGTGATCAATGAGTGGCCGACGCCGTCGAACGTCAAGGAACTGCGACAGTTC
CTTGGCATGGTCACGTACTTGTGCAAGTACGTGAAGGACTACGCGGGCATGATACGCCCGCTGTCACAGCTCCTGAAGAAGGACGCCGAGTGGGTTTGGA
CTGCTGAGTGTCAGCAGGCCTTCGATGCAGTCAAGCGGGGCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCGTTCCACGTTGTGTG
CGACGCATCCGACTTCGCAATCGGATGTGCCTTGATGCAGCACGATCACGAGGGCCGTGATCGTGTCGTCTACTACCAATCGCGTCAGCTGAAGCCAGCT
GAGCGCAACTACCCGGTTCATGCCAAGGAGCTCCTTGCCATGAAGTACGCACTTGCGAAGTTCCGAGTGTATCTACTCGGAAGCAAACCGTTCGTGGTCT
ATACGGACCACGCGTCGTTGCGGACGGCTGTGAAGTCGCCGCACATCTCCCAACGGATGGCAAGATGGCTCTCATTCTTCGCAGAGTATAACTTCCGGGT
TGAGTACAATCCCGGAAGACTCAATGTGGTGGCCGACGCGCTCTCGCGTCGACCTGACTACGCCACGACTGATGCCGACGTCAATGCCATTGACGCCATG
CGATCGAGCACCCCGACGTCGTCACTGTTGGACGACGTGAAGGTCGCGTACGCGCACGACGCGGACGCGAAGCTCTTGCTGGCCTACGGCTCAGCGCCTT
CTGACCAAGCTCGTCAGAAGCTGCCGAAGCATCTTCGTGCTCGTGCACACCGTTACCGGGAGCACGACGGGTTATTACTCTACAGTGCAGTCGACGACAA
CGCGGACCGCGTTGTCGTGCCCAATGACCATGTCCTGCGACTCAGGATCATGTATGAGTATCACGATGCACCGACTGCGGGGCATCCGGGCCGTGAGAAG
ACATACCTTCTTCTCACGCGAGACTTCTACTGGGCCCACCAGTATAAATGGGTGCGCAAGTACGTCCGTGCTTGCGAGGTTTGTCAACGTGTGAAGCATG
CGCCTTTCGCGCAGGCTCCCTTGCAGTCACTGCCGACTCCGTCGGAGTGTTGGCAGTCCATGTCTTTGGACTTCGTGTTCAGTCTTCCCCCGGACAGCCT
GGGGAACACGGGCATTGTGGTCTTTGTTGACCGCTTCAGCAAGATGGTACATCTTGCTGCGGTACCCGCTGAAGTGACTGCGAAACAGACGGCGCGTCTG
TTCGCTGACATGGTGTTCAAACACCATGGCATGCCGATCGACATTGTGTCGGATCGAGACCCGCGCTTCACTGCGCACCTGTGGCAAGAAGTGTTTACAC
TTCTTGGGAGTCAACTTTCGATGTCGACTGCGGACCATCCGCAGACGGACGGGCAGACCGAGCGCGTGAACCGCGTGCTCGTAGACGTGCTTAAGAGCTA
CGCTCACTCGTTCCAACACTGGAGCGAGTGCCTGCCGATGGCGGAGTTCGCCATCAACAACTCGGTACATGCCTCGACCGGGCATACACCGTTCTACGTG
AATGCCATCAGGCACCCACGCCTCCCGAGTCTACTCGGGATGGTGGCTCCTTCCTTAAGTGGGGGAGGATCTATGACTGCAACGCAGCAGCCGCAGAATG
CCGCTGACACTTGCACAGTGTCAGCCGCGACTACGCGCAAGGAGAAGAAGAAGAAGCACGCGCCTGTGCCCTGCACAGACGCCGACAAGCGCAAGAAGAA
GAAGAAGAACGGGTCTGTGCAGGGCACAGACACCGCGAAGACGAACGCAGAGGCCGGGCCTACTGCTAGAAACGAGCTGAACGAGTTCAGCACGGACGCA
ATCAACTTCGTGCAGCGCAGACAAGCCGTCATTCGGTTTGTCCAAGAAGCTATCGCAGCTTCTGTCGACCGACAGAAGCTGAACGCAGACAATGTTGGTA
GGGGCAACACTAATGAATTCAAGAAGGGTTCATTGGTTTTGTTAGCAACTCAAAACC