Description :
From Genome Similarity Track
Location :
Scaffold_504:3302- 6154
Transcript NameFunction/comments
Albla_Nc14135080
Albla_Nc14135090
Albla_Nc14135100conserved hypothetical protein

Sequence
2852 bases(100 bases per row)
CTTACGTTTTCTTCTCAATCGCAAACGCAGCAGCCTCTGCTTCTTTTCTTTTCTCAGAAAACCGACTTTCCTTAGCTGTAGTCTCTCGCTCCAGTTTGTT
CCATTGCATGGGACTTATCTGTGACATTCAGACCTTCATTGTATCAACTCTTATACCCAATATAAACTCACGTACCATCAAATTATTGCAATAGATGTAC
TTTTGGGGATGCTTTCCAAACACATTCTCGTTCGTCATCATAGCTGCTGCTCGGATAAGATAATCCGGATACGGATAATCGATAATTTTCGTTGGGAGAT
CGATTCCAAACTCAAAGGTTCCATCTTTTCTTGCTTGCATGATCTCTTCGTGTAATACTGCTTCTACATCATCTTCAAAGCCATCCGATTCCTCAGACTT
CCCATCCTCTTCGCCAATCATATGCAAACTTTCTGTGTCATCCACTTCACATTCATCGGCAGTGGATCGTGCCATTTCTTGTTCCTCAGCATCATCCTCG
TCGATGTAATCTGATTCTATCGATTTCTCTCGTTGTGTAGCATCGTGAGGTACAAAGGGTGCTAGTCGTTTACATTTCAGAGTATCAACAGCACGGAAAT
CTCCGATATCTATCTTACTTTCTATAGTCTTTTTTTGATCCTGACCGTATAGTGCCTCTAATTTTATGAGTGGTGCTATTGCTGATTGTGCTTGTAAAAT
CGTCTGTATACGCACGTCGGTATTAAATGGAGCTGGCTCTGACACGGAAGGACTTGTTTGCATTGTATCAGTTCCTAGTTTGATGTGTGACACATCGACA
TCGTCCTCGTCCGATGATGAGGTACTGCTATCACCACTGCTTGTGCTGCTGGTGTCACTGCTGGACGTGGTACTCATTGTGTACACGCAAAGAGTGTTTG
TTTGCAAACATGACTCTGTACGAATCAAAACGTTTACATGAAATGTCCCATGCGGCGAAAGCGCCTTGCCTGTGTGAAAATTTTAATGAAGACTCTCTGC
TTTGTGAAATTCCTGTACAGTCATGATTTCAACATGTCGCAAATTAAGTGCACATTGTGAAGATAGGTATCCATTTGGGGCTATGAATTTGATCTTGAAA
TTAGTATGTTTGAAAGTATGGCCTGCAGCTTTCGCTGTCATATCGATGAGTCAAAATGGGCGATTCGGTCAGAGTTAGAAGCGGCAAAGATCGCATGATC
GAGAGCCTTTATATATCTAACGTTGAGTGTCACATTTAAATAAAAAGTCGATTTTATTCAGTAATGGGACGAACGTAATGCATCAGCTAGAAATCTCCTA
GGCTAAACTTTCTGTAATCAGAAGTACAGGATCAGACTGCATAAGAAAAAGCCATGCAAAATTTGTCTAGCTACCCTATACGCGTTTATCCGAAGAAATG
TTTATAGTTATTGTATGAACAAAGGCGGGATGACCCGTGACACACCAAATACACATCTTTACCACCTGTCGAAGCCTTCCCGTCGTAGAGTAGTAGAGTG
GAGGAAGAAAGGAAACATTAACTACTCGTATTGATTCTTTGCGAGAATCATTTACCCTAGTCAATCAAATCGCTTGCAATCAAGCGTTACATACAATCTG
GAATATTTTCCATCTGCCATAAAAGGTAATCATATCCCAAACGGTCGTTTCCAACTTTGCTTTTCTGAAAATCTATTTCTGTATAGAAAAGGTCAGTCAA
AAAAAGTGTAATCACAATCACTATCCAAGCTTGGAATTACTTGATAAGAAAAAGAAAAGTTGGATCAAAAACGATCGTGCGTTGTGCCGATATTGTGTAT
TAGTACCTCATACCGCCCGCTCACGCGATAAGACCAGAGGTTAACTCCAAAGCACACCATTTCCAAGCTAATTGTAAATTCTAATAATATTCTTGCTGGT
TTCGTTTCGTGCAGCTTGTGTTACAGAATGGCACGTCGGGGTACAAAAGGAAATGTCATGGGAAGCAGCGATGTGCTAACGATAGATCAACTACGTCATC
AAGATGATTGGGTGCTTGACACGGAGCGATATCGATGTCATGTTTGCACTAGAAATTTCACACGTTTTCGAAGAAAACATCATTGTCGAAAGGTACGCCA
TTTATATCTCTCAACTTATGAGTAAATTGAACCCAGTGTTTCTCTAGTGTGGCGAAGTAGTATGTGGCAACTGTACATTAAAAAAGGAAGCAGAACTGCC
CGTCATTGGTCGATCGTTAGTCCGTGTTTGTATGTCATGCATCCTATCGCATGCGAGTAATCAAGCGAATCCACAAGCTCCTCCAGTCACAACGTCTTCT
GAGTCCACCCCACCCCCAAGCGAAGACCGATGGGACGCACGGAATTTTCAATCTCCCATAGCAGACTCTGAAGATCTTACTCAAGTCACACGCGAGTTCC
CTCGCTCTGAATTTGAGTATCCATTAGACTTTACGTGGGATCATCCATGGCCGAAACCTCCCATGGTGATTGGAGAACCTGAAAGACTTGATGTCTTGCG
TAGTTTTGATATCATGGACACTCCAAGCGAAGACGTTTTTGATATTATTTGTGATCTTGCAAGTAACGCTCTGAAAAGTCCCATAGCAGCTGTCAGTTTA
ATTGATGAAGATCGAGAATGGTTCAAAGCTAGTGTTGGTTTGGCACAAAATGAAGTACCTCGATCCGTGTCATTTGGTGCACACGCAATCATGTCGAAGG
AACCGATGGTCGTGATGGATACCTTGACCGATAAGAGATTTGCAAAGAATCCTCTGGTTACCGGTGCAGCAAAGATCAGGTTTTATGCAGGAGCACCCAT
TTGCACACCTTCGGGACATGTTTTGGGTACAGTGTTTGTATTTGATACACAA