Description :
From Genome Similarity Track
Location :
Scaffold_423:3302- 4602
Transcript NameFunction/comments
Phyag_g5585T-complex protein 1 subunit zeta
Phyag_g5586hypothetical protein PHYSODRAFT_284638

Sequence
1300 bases(100 bases per row)
ATCGTTTGATGCGGTTTTGTCGGTCAGCTGAGCGCGATCGTTCAGCAGAATCccggtttcttcttggcggcgaACGAGAGCGGGAACGTGAACGCCGGTC
TGCATCTTCATTTTCCCTTCTATAATGACGATGACGCGGTttgtcgtcttcctcctcttcagaATCACGTGCATGATGGCGTTTccccttcttctccctc
ttccgttctttcttctctttcttcttcagcttcttaGCAGCTTTCTCAGCCTTGTGCGCCTCCTTCCGTGCtgccttcacctccttctccgtcatccTTT
CACTCATAGTGCCTGGCAACGCATACGTCGTATCTGCTTTTCCACTTGCAAGCTGGTCCTTGTATCTCTCCGCCAGCGTCCGTTTCGGCCCCGTCTCGAA
TCCTGCAGCCTCCACAGGCGCTGCACCAAGTCCTTCAACACGCTCCACATCCATTCCATCCCGTTCCGCCTCTCctcgcttcagcagctccttcatctcc
gaCGCACTCAATCCTTCCACAGGTTCGTGACGTCTCTTCGGTGCGATACCTCTAGACACAGCACACAAAGACACCGTAAGCTTCTATATCAACCGTAATA
TCTCTCCATCCATAAATCAATGGACGTACAGCGCTTCGTTCATGAGATCTTCGTCTCTCTGTTTAGCTTGAGCCAGCTCCGCCTGTAGCGCCTCAGCTCT
CTGTGATTTGTTCGCCTTGGCGTACCATGTCAGGTCCTTTCCCTTCTGCCAGCGACCCACAGGCGCCTGCACCGAGTGGCCCAGGTAGTTCTCTCTGTAC
TTGTCGTTCTTGACGTCCTCCCACTTGAATTCtacagcgccaccacgagaGAAAATTTACTGACAGTTAGTACATTACATCAAGAACTAAGTGGTACCAG
TAGACAGCTTCATAGCGACGTACGGTCGGCACCGCCGCGTGTGCCGCCGACGCGATAGTTGGTCTTCCCGAAGCTCATCGCTTGTCGTTTCTCCAAAAGA
AAATAGAGATGATGTACAAAACACTAATTTCATACAAAAAGAAGATGATGTACAGAGCACAACGGTACCTGGTACCACTAGCTGCGGTATCTTCTTATTT
TTACGGTCTCTTCCGCAGGTCGACAAAAAAAACTCAGGAGCTCCGATACTTCGCCATGTCTGGAGGTaacggaggcggcggcatcttcgctgGAGGCAAT
AGCGGTGGCGTCACAGGCGGAGGACCAAATGGTGCCAACATGAACAATTAtagcaccttcttctccgcagACCCGGTGCGTCATAACGTAGCAATACACG