Description :
From Genome Similarity Track
Location :
Scaffold_68:330117- 332427
Transcript NameFunction/comments
Hyaar_Emoy2807750chaperone clpB putative

Sequence
2310 bases(100 bases per row)
CGCACCGCCGCCAGACGCGTCCTGTTGCCCCATTCCGCGCGCGCACTCTCCCGTCGCTGCTTTGCCTCAATAAGCGGCGCCTCGTCGCCCTGGATCAACC
CCGCGAACGTCCCGCACGGCGAGAGCCTCAAGAAGTACGGCCGCGACTTGACCGCCTTGGCGCACGCAGGCGAGCTCGACCCTGTGATTGGTCGCGAAGA
CGCGATCCGGCGCGCGACGCAGATCCTCTCGCGGCGGACCAAGAACAACCCGATCCTCATCGGCGACCCCGGCGTAGGCAAGACCGCCGTCGCAGAAGGC
CTAGCGCAGCGCATCGCACTTAAGGAAGTGCCTTCAAGTCTCCAGGACAAACAAGTTGTCGCGCTCGACTTGGCCGCGCTCGTGGCCGGTGCAAAATTCC
GCGGCGAGTTCGAAGAGAGACTCAAATCCGTACTTAAGGACGTGGACGACAGCCACGGCCGCGTGATCCTCTTTATCGACGAGCTCCACACGCTCGTGGG
CGCCGGGGGCAACGAAGGCTCAACAGACGCGGCCAACATGCTCAAGCCGGCGCTAGCGCGGGGCGCGCTCCACTGCATGGGCGCGACGACGCTGGACGAG
TACCGGCAGTACATTGAGAAGGACGCGGCGCTGGCGCGGCGGTTCCAGCCCGTGCTGATCGCTGAGCCGAGCGCAGACGAGACAGTGACGATCCTCCGCG
GGTTGAAGGAGAAGTACGAAGTGCATCACGGCGTGCGCATCGCCGACAGCGCGTTGGTCGCGGCCGCGACGTTGGCGACGCGCTACTTAAGTGAGCGCAA
GCTGCCGGACAAGGCCATTGACTTGATGGACGAAGCGGCGTCGCGGTTGCGGCTGCAGCTCGAGAGCAAACCCGAAGCGATCGAGACGTTGGACCGGGCG
TTGCTCTTGCGTCGCATTGAGATGGAAGCGCTGCGGCGCGAGACGGACGCGGCGTCGAAGAAGCGCTTGAATGCGGTGGAGATGGACGTCGAGCGGGTGG
AGACGGAGTTGAAGATGTTGATGGACGAGTGGCAAGCGGAGAAGCGCAAGTTGGAGGCGATGCAGGACGCGAAACGCAAGCTGGAGGAAGCGCGGCGGGA
GCTCGTGACGGCGCAGAACAGCGGGGATTATGCACGGGCAGGAGAACTCATGCACGCGGTGATTCCGCAGTTGGAGGCGGAAGTGGCGCATGAAGAGCAG
GAGGAGGAGGAAGAAGAAGAGAAGGGGAAGAAGAAGAAGAGTCGGAGTCGCACGGCGCTGGGCGATGCTGTTACGGCGGATCATGTGGCGGAAGTGGTGG
CTCAAGCGACGGGCATCCCGGCGTCGACGCTGATGGAAGGAGAGAAGCAGCGACTATTGCAGATGGAAGAGCAGTTGAACCAGCGCGTGATTGGCCAGGA
AGAAGCTGTGACGGCTGTGAGCAATTGCGTTCGGTTGGCGAGGGCGGGACTGCACGCGCACAATCGACCGCTGGGTGTGTTTCTGTTCCTTGGCCCGACG
GGGGTCGGGAAGACGGAGCTGACAAAAGCGCTGTCGGAGTTTTTGTTCCAGACACCGCAAGCACTTACGCGCATTGATATGTCAGAGTACATGGAGAAGT
TCAACGTGAGCCGTCTGATTGGCGCGCCAGCGGGTTATATCGGCTACGAGGAAGGTGGGCAACTCACGGAAGCAGTGCGCCGTCGCCCGTATCAGGTCGT
GCTCTTTGACGAGTTTGAAAAGGCGCACCATGATGTGAGCAACATTTTGCTGCAAGTGCTGGATGAAGGGCGACTGACGGACTCGCAAGGTCGGCTGGTT
GACTTTCGTAATACCGTGATCATTCTGACAAGCAACCTGGGGTCGGATATTCTTGTTGGCTTGCCGGAAAATACGCCGAGCTCCGTGGTGGAGTCGGAAG
TCATGAATGTCGTACGCGCACACTACTCGCCGGAGTTTCTCAACCGCATCGACGAGCTCGTGCTGTTCAACCGCTTGAAGCGCGAGGATATCCGTGCGAT
CGTGGACTTGCAGCTCCGACAAGTCGATGAGTTGCTCGAGGAGAAAGACCTGACGATGAAAGTGGACGCGCTAGTCGAAGACTGGCTGGCGGATGTGGGC
TACAGTCCACACTATGGCGCTCGGCCACTGAAGCGTCTGATCCAGCAGCACGTTTTGAATCCGATGGCTGTGAAGCTCCTCGAAGGAGCTGCTAGCCCGG
GCCAAGTTATGCACGTCAAGATGAACGCCAACTACGATGGAGAAGTTGTCAAGGACGCAAAGACTGCCAAGCCGCTGCTTATCACAGTCGAGGAAGCTGC
TGCAGCAGCG