Description :
From Genome Similarity Track
Location :
Scaffold_548:330- 2871
Transcript NameFunction/comments
g17301.t1hypothetical protein

Sequence
2541 bases(100 bases per row)
ACCAAGATTGTTGCAAAGAGCTGGCGCAGCTGGTACGGCATCTGGAACTCGGCAGCCTCCGACAAACACAAAACCCATTCGCTGTCGTTCTCCAGATAGC
CGGCATGTTCAGCCGCGTCTCGATACGTGGGACACAGCACACCATCAACTGTCCGCAGGTCTTCGAAAGACCTCGGTCCTCGGCGATGGCATAGTAGCAG
GCGTAAATAGAAGCGCTCCATATCACGCGGTGAAACATGCACCATCCGACCAATTGCAGCCTGGTACCTTTTACGTCGAACCCAGCACTTCGTGTTTCCC
ATCCAGCGGAATTCCTTGGGTATATCCTGGTACAGCATTGTCTTCGCGATCTGGTTCTCGGGTTCGTCGCTCGCACACAATTCGAAGAAGCGGGTCAACA
TGGTGTGATTCCCACGACCAAGGACACGCTCCGGGTCTTCCGTCGCTCTGAAGAACACGGTTTGGGCATCTTCAACGTGAACGGTAAGCTGAGTGACTGC
GTGTGTCTTTCCTTGGATCAAGAAGTCGAGTAAGCGGATACAGGCTTCAACTGGAGATATGTACCTGGCCGTGAGGAAGCGCAGAATCTCGTTCGGCTCT
TGCCGAGGGAGCTCTCCACCCGCGCGAACTGCCTCGACAGTTAGCACAGCTTTATCAGACCCTTTGTAGACGATATTTCACAGCTGAAATATCCGTGCAC
ACCTCGACGTTGATATGGCAATTGTACTTTTGGGATAAGTACGGGTTGTACGGAACAACCCACTGGTTAATAGTGGCGTTGTCGTACTCCCTGCCTTTCC
ATATCAGACGCCTTCAGCTCGTCGACGCCGTCTGTAGACCGGATAGCCGTTCACATTGGTCTGCAAAAGGTTTCGGATATCCTTTCGTACACTTCCCGTC
CTTCATGCAAGCGCATGACGGGTTTGCTGCTCCACAGGGTCCATGCAGCATGCATGTCATGATCGTCTCGAATAGCTGCGGGAACTTTTCTCTGTCAGGA
AGCTCTGCAGACACCATACCATCTACGATTTGGCGAGTACGTGGCTTGTCCTCTTCAGCCAAAATGATCAAGATGTGCGCGTGAGGGAGCCCTCTCTTTT
GAAACTCGACCACGTAAATCCGCGCTTCCATACGGCCCAGCACTCCTTCGCTCAGGTCTTTAAGCTGAGCTTGCAGTTTTTGCTGCCAGACACGGGCTAC
AATATCGGGGCGGTTCTGAGCGTTTTGTTGATCGGACCCAAGGGCCTCGACTATCTTTTCCCATGTAGGGCTGCAGGTCGTTGTCATGAACACATCAGGC
TTGCCGAATTCTCTAACAATGGCCATTGAGTCTTGGTAGGACTGGTACATTGCTCGAGGACTGCCCATATGAGATGAGGGCAGAATAACGCGGCGTCCCA
CTTGGTTGAGAAAATGGGTATCACCACCACGGCCCCGATCAGGGTGGACCAACGTATTATCGCCTCTGTCAAACTCGGAGAGTAGCCCTTCGCCTGCTTC
CAGCTGAATTGTTCCTTCGTTCAGCAGTGCGTCCTGAAGCCCTCTGTATTGATCGGCGCGAATTTGCTTCTGATGTGAGGCCACCCAGCGAAGTTGCTCC
TGCTCGCATTTAGCGCGTTGGTCGACACACCACTGCTGAAAGAGACGGCCGCCTTGATGAAGAGCAGACTGATCTCCCACTCTTTGGTGCAACCGGAAGG
CGACATGTTCGCGAAGGGACATCTGGTTCTTGTTGCGATGTCTGACTCCGTTCGCGTATGTGTCTGTGTAGGTCCAACCTAGCTCCCCATACGGAAGCAG
AAGAGGGTACTGAAGAGGATCATACTCCGGGCGCGTCTCGAACAGTCGCAGAAGCCTGTGATCCCGAGTATACAGTAGTAGATCGCGAGGCCTATCCAGG
TTGCCGTCCTCGATGAGCGTCGCGCCTACCTCAGAAACGGTTGGCAAATTGTATGTCCGAGGATGCGCTATATTTTCGTGGAGGCGGAACACCATATCCA
CGACGTCGCTCGTGTCTCGCGAGCGCACTTGCTCTCCGAAACTCAGGAACTGCTGAGCAAATGGGTTGTGCTGCTCCATCATTTGCTCAATGTCCATCAA
CGCCACAGGATCCAAGTCAGCAAAAATTCCTCTGCGGCGTTGGGCGCGCTGCTGCATGTCCGGGTCCACAATATAGATCTGCGCGAACTTAGGGTCCGTG
CGCTCTCCGGTGGCGGGATCAATATAGGGGAGTAGAGATCCCAAGTAGTGACCCATTGCACCCTGGATGCGGTACGTGTACACGCCCCTCTGTCCCGCTA
CGCTTGCATCCTGGTTGACGTCCTGGAAGGATCGGTTGGAGCACGAAGCGCCAATGGACGTGAACGCAAAAGCTTGGTTATACGCTCGTATGTGCTGTCG
AAACGCTGGATCCCGGTACAGTTGCAACAATCTTGGAGGTGCAGGCCGTAAAGGGGGAAGACGAACCTTGTCTTCCAGACAACAGCTCATTTTGGATTCG
CCAGGCCACTTCCAAGCGCCACAATGTTCACAAACAGTGGT