Description :
From Genome Similarity Track
Location :
Scaffold_2051:330- 1516
Transcript NameFunction/comments
Phyag_g11966hypothetical protein PHYSODRAFT_543712

Sequence
1186 bases(100 bases per row)
GGGAAGGCCTTGGCTAGAAACCCGACAATGATAGACCTATCGTCTGCGCTGCTTACACCCATACTCTTCAGCTCGCGCGAGAACGCTGGTACACTACTGA
TCCCGTTGCTGATCAGGTTGAGTCCCAAAGTGGCGTACAAGATGATCTCTGGTCGAGTGAACGACAGAAACGTTTGCTTCGCGCTCTCTGAGCACGTCGG
GAAGCAGTCCTGCCACATTTTCTCGCGTAATCTCGTCTTCTGGTCGTTGTCCGCAACCTTCACCAAATGAAAGTGAACACAACATAAGGCACTTGTCATC
CAGCATTCGCCATTGAACAAAACCGTACCGATACAGGAATGGGCGCCGGCATCTCGCCTCCATCCTGCTCCGCCTACCAACGATACAATTCACAGAGAGA
AACACATTGTCTGTGTGAGCAACAGAAGAAACGCCACATGCTCATGGCTTGTCGAGAAGGGGGTGGATGGGCCCTACCGACAAGCCAACCTGACGGAGCT
CGTGGGCACGGAGATTGAATCCCCGCGCGGTCAACTGCGTCGCCTACAGCAAGGACAGCACCAGCCAACCAACGATCACATCCCTATAGTGGGTATCGTC
CCGCAAATATCTCCAGGCCAAGGCAACTACAACATGCAGCTAGCCGTACCGTCGGGTCCTTCTCAATGTAAATCCGGTACGCCTCGTTCGTCCGTAGACG
TGGCGTGTACAGCTTGGTCTTCCATTCCTGTATCAGCCAGACAACACATCGAAGCATTGTGTTAGGATAATGAAATTAGAGAATATCGATCTCAATGGCC
TCCAAGCAGAGCGATTGTGGCTCCTTGTACAgtcgtgcagcacctccgtctcgtcctcgtcgtagtcgaacTCAATGGGCGCAATCCACCCTCGTTCCAA
TAGTCTAGCCAGGATATGCCCCGCCATTCTAGTCCGTGCTTCACCCACTAGCGTCGTAGCAGTCGCAGTGGCTGTAGGCGCAGCTGGCGCACTGCCGTCC
ACGACCAGGTCGGAGTCACAGCTCTTGGCCGTCGTCATCTGCGTGgtgaagagctgcacgccGTCGCGCTCCAGCCACTCGCGCAGCACCGTCTCTTCCA
TGAACTCcatgtcgttctcgtccgaCGTCTCCAGGATGCCGGcgtgctcgagcagcacgacgaactCGTCTTCACTCATCGTCTCT