Description :
From Genome Similarity Track
Location :
Scaffold_482:33- 6366
Transcript NameFunction/comments
g9070.t1ETK87916.1 hypothetical protein L915_07707 [Phytophthora parasitica
g9071.t1hypothetical protein
g9072.t1POM74471.1 Integrase catalytic core protein [Phytophthora palmivora var. palmivora

Sequence
6333 bases(100 bases per row)
TTACGCCTACAGGAGCGGTCGCAGTTTGCGATGTTACAGCGTTTGCCTCCACCGTGGTGTGCGCAAAAGCCTCCGCCGCGGTCGTTGCGCATGCAGCCTG
GAACCTCGCAGAAGCGAGAGCCGCCATGCAGCGCACAAAAGTCTCCACGTTGTGTACCTTTGTTGCACCCTTCAGCGGCGCAGCGCTTGCCACCTCCGTG
TGCGCGGCAGAAACCTCCACTTTGGGAGCTCTTTGTGCAGCCTGAGTATTGGCATCGCGGGCCGCCACCGTGCGCTTTGCATAGTGAGTTGGTCTGCGCG
GCTTTGTCACATCCGAGGTGTTTGCAGCGCTTGCCACCTCCGTGCTTGATGCACATGTTGCCTCCTTGACTACTCTTCTCGCATCCCTCCACAATGCATC
GGCGGCCGCCACCGTGAGCAATGCACAGGTCCTGCGACCGCGCGCGTTTGCCGCACCCAGCCACCGAGCACAACCGACGTATCCGTTTGGCCTTCTTTGA
TCCGTCCTTGCTCGTTGTCAAGGTCCTGGAAGTCGCACCTGACGCGACAGCGGTCGTTGGTGTCGACGAAGACGACGTTAGGTTGACGGTTTTTGAAATT
GGCGATGAGGAGACCGTCGAGAAATCAGAGGAGGATCCGTTCCAGTCGCTGTCATCGTCCTCTTGGAGCGACAGATCGGACATCGCGAATCCACCATTGA
TGGCAAGCATGCTGGCAGCAGGAGGTTGGGCGACCTCATTAAATAGTGTAGTTGCGCTGTTGTTGCCCATGGTGCCCTGGAACGTGGGGTCGGTGACCAT
CATAGCTTGTGACACCCCACTGTTACCGAAGAACGGGGTCGAAACCTCGCCCAGGTGATTGTCCATCGCGTGAGGCGTGAACTGAGCCGTGTTATCAAAT
GCTGGCTTGTACATTCCGTTATCGTAGGGCGGGAAGCCACTCACGGGTAGGGTCGTGCAGTCCTGATACGGCATGACGAAGCCGCTGTCCATGCTGGAGA
AGGGGTCTGCAGCGGGGCCCACCGTTGTGGACTCGTTGTTGTTGTCCATGGCACCACTCACGAAGTCTGGCTCCGTGGCGACCATGCCCAAGATATGCGT
CATTTCGGCGCTCGCTGACGGGGTCATCATCATGGATCCAGAGAGCGCCACCTGCTGGTTGCTGCCGGCCATGAACGCGGCGTTCGGGTCATACAGTGCC
TGCGCCTCGGTAGGTGTGGGCTCAAAGCCCCAGTTGGCGACGGGCGCGCGCGGCGGGCCGGCGTTGAGGTTGGCGAGCATGCCCATCATGTCGCGGTCCA
GCTCGAAGGTTGAGGCCGCCACCATGGCAGGATCGTCCGAGCGCTCGGTCTTGAGCGCGATGTTGCTACTGTTGCTTTGGGAGTGACTGTGGCGGTGGTA
GTCCGCGTGATTGCCAGTGGCGCGGTGCATCGTGGGCTTGCTCAGGGCCGCCGCCTCTTGGATCGCGTCACTGAAGGACATCGAGGGCAGGCCACACGAG
TACGAGGACGGCGATGCCGGAGACCAGGCCGTCTCACACCCGAATTGATCTTGTTGTTGTGACGCCCGCCGCCGATCCTCGGTCGGCTGCGCGCGTGGCG
CCGCAACGGAGTGCGATGCTTGCTCCATTGAAGAAGTGCGGCGCCAAGCGGCCCCCGTGGGAGCCTGTCCGTGTCGCAGTGGGGAGCAGCTCATCGCTGC
CACGCACCCGACGTTAAACTTTAAAGCTGGGGCTCGGGTCCGGCCGCTCTTCTTGTCTATGTGGCGAACGTGTCAAGTCCACGTCGGCGTCGACCGCTTT
CCTGTCGGGTACGTTGGGGTACCGGACGAATCGCTAAATGAGCTAAACGAACCCTCTTCGGACCCGAGGAAAACGGGCTGGCGCCTACGAGCCGTGAGAT
TGTATTTCGCCCTTGGGGGCGACGCGACACAAGTTGATACTGGCCAGCGGCATACAAACGCTGAGTCACTTGCGAGTCGAGAAACGCACTCGCAAAGCCC
AGGAAAATAGAGAGGGCGGTCGAGTACATGCACGATGCTGCTGGTCGTGGTTCCTTTTGAGTACACCGGCGAGACGCTCGGAAGGTCTATCCGAGCGGGG
TGGAAGGCAACGCGCGAGGCTGAGCGAGGAAGAAAGCTGGTGGCCCATGTGGCGGAATTCACCGGCAAAACGATACAGGACAGTAACAGTGGGATGTGAG
ATTCGATCCCAGGACCGGCAGGCCAGGCAACACAATCGGCTCGGTCCCGGTCAGCCTTGCTATCTGAGGGGAAGGGATTGCGGTCCCAGGGAGCTACTAC
CTAGTTGAAGATGACTGCTGCGCTAATGTGGCGGCACTTGACACCAGTAGGGCGATCGTCATTTACATCGCTGTGGACGATACTACCGTCATGGCATGTT
GCAGGGCGTCTTGTAAATAAAGCACACCGGTTTTGGCGCGCCAAAGCTTAGGTACCAACTTCTGGCCTAGTAAAATGGTAACGTCGTATTCGACTTAACA
CATTTTTACAAAACCAGATTGAAACGCAAATTTGGCAGGATGGCGACAAAAATGAGCTTCGCCTCTGCTTCAGTGACCGCCTCCACTGCGGGTAGCAAGC
ACTGGTGCCGAGACTCCACCACACCTGGGAAAGGTCCTGCTGTTTACCCGTTTTCCCCGCGATGTGTGAACGCCGACCAGGCTCGAACCATGACGAACTG
CGCAGATTTCAGCGAGCTTCGCTCACGAGCGTCCGACCTGATGGTGAGATCCACGTATGTACGCTCCCCGGTTCCCGCTCGGGCCCATAGAAGCACCTGG
TGAGCGGTCGTCATTGGCATCTCATTCGCGACAGCGGTCGATCGGTGAAGCGTAGACTTTTCAAAGCGCTTCATGGCCGTACATTCATCGAGCATCAAGC
AGGATTCTAATGTGGTGCGGCCCCAAAAAATAGTGGGCTCGAGTCTATCGGCCCCGCCGCGCACTCAATGACTAACGCCCGTTATAACCGAGCCAACTTT
TGGCTTCGCGTTTATATGTCATAACCGAGACAGAGCCATCAACTTTTGACACATCGCGCCTCTTTGCATCCTTGAAGCGCGTGACTACGTCCCCATTGCG
TGTTTCTCGCACGCAGCGCGACTGTATCGCTTGGTGTACATGTAGTTCCATGCGAATTTGCACGGCGACCGTGAGGTTCCCGATCACGTAGCTGCAAATG
CTGCATCATGTACATGTAGGACACTGACAATGGTGAGGCCTACATGTAAGACCCCCTTATCAATCAGCTTGTGCTATACCAGTACGTACTCGTCAACTAA
GGCTCGCGCGGCGTTAAAAAAAATAAGACTTCAACGTCTGCGACCAAGATATGCACCTGCGACAGCCCAATCAATATGTAGATGTGAAGAGCTCGCGCGG
TGCCAGCCTACCCAGTGGACTTCTTCCGCTGTTGGATTTCTCGTTGAGTTGGTGGCAGTGGCGCGACGGTGGCACACCACAATACCTTTCTCCACGTGGC
AAGCTGCTCTCGCTGCCCCCCAAGCGTGCCCCTAGCAAGCAACTCAGCGGCGCTGCTCCAGACTTCAGTCTTGCAAGTCAAGCCGACGGCCGGCGTTTAC
AGCAGAGCAGATACGTAGTAGTTGTGCAGTTTGCTGCTTTTGGAGGACTTATACTGTATATCGATGGCTGTTGCTCCAACACGGCACTCACTGGCGTACT
ATTCGTGTTGCTCATGCGTGTTCATTCGTTGTTTGCAAGGACGTCCTACTTTTACTTTGCAGGATACGCAGTGCTGTTTGTTTGAAGATGACTCAGCCGT
GCTAGGCGCATACTTAAGTGCAAGCCTTAGCTGGCAGCGCGGGGCAAAAGCGTAAGCGAGCTATTCAGCGGCGGGCTGCCACGCAATAGTAGCAGTTACG
CGCTAGGACTCAGAGGCGGGAATTTTCGGTGTCGTCTTCATGGTGCGTGAATTGCCGCTCATGGCGCTGGTCTTTTGGCTACGGAGGAAGACCAACTTTG
TTCTCCGTTGATTTGATAGTCGACTTTCGTTTCAGGTCGTTTCACAGATGAACAAGATGGCTTCGACCTGGTCTGTGCTGGTCGATGAGCTACACGTATT
GAGGTACCTAACAACCGATTTTTTTCAACATGGTCGCAGGTCGGCAGTGCTTTCATGTTCAGCGTGCAGCTATGACAAGAATCGGTGATCGAATTTCTGT
GATCCCAGTCGTCGCCAAGCCTCGCTGGCCCCGTTGCGAGGCACTGGTGGGAGGAAATGGGCGAAGTGCAGCAACTTATCATTCTCCTCTATTAGTACAC
GGTAAGGGATCGCGCTACCATGCACTTCGTCTCGAGCGGCTAGCCTCAATTTTGATCGTGAACTATGCAGCGAGCAACAGAATTGCTTGGAATGCAAGCA
GAGGTTTGTCTACGTAGGTCTCTGTATTAACACTCCCGTAGATGGGTGAGTTATAAGCGAGCGAAAGGTGCTCAATTGGATATGTACACTAAACTCTTCG
ACGAGCTTGGCGTCCTCGCAAGTGGGGGCAGTTGTTGTCTTCACGTGGAGTAAGTGTGTGCTGTCCGCCAAATGTTTTCACTACGGTGTTTCCCAGCACG
GACATTTTTCGGCGCTGGAAAGAGGAGATTCATAAATGTTGGCAAGCAGCAGTCCCACACAGGTGGCTGGCTGATCAGTTCCGCTACGTAACCGGAATAC
ACGGACAAAAATCGATCGCGACATTAGGTGTCCTTGTTGTAAAACAGACACCTTTTAACAGAGCGAATTTGGCCTCATTCTCGGCAACGATAAACAAACC
AATACGTGTACAACGTACTTCAATTCTACTTTGATATTGTACAGCAGATATGTGTCTTTCGACTGTTCATTTCCAGTCGTCTGCACCGACGTCACTTCTT
CTGGCGCATTTGCAGCGACACTCGCAGCTGCAGGCGTCCCAGCAGTCTCCCGCCAATTGTCAGCGGCACACACACGTCACGCTTCTTGGTCATGCCCTCG
GCGCAGAATGTGCCGTGCCCGAAGAGCTTCTCCGAGGAGAACGATGAGGACGAGCCTACAGAGCTCCCGTGGGGTGTCGGCGAGCACGTCGACGCGATCG
AGTTGGTGCTCGTATGCGGCGACGGTGAGCAGCTGCCTCCTAACAGCCGTGAGGCTGATGACGTCTTGGACATGGATCGCCCTCGGCTGAGCGAGCGCAG
AACCACGGCCACATGCTTGCGGCCAACGGCGCCCACCGTTGTGTGATATCGTAGCCCACCGTTGACAAACTCATGCCATTTCAAAGTGTGGAAGTTGGAA
GTGGGCGTGATGGTGGATGCAAACCCCATGCCTCCAGTGTTGCCATTGTCGCCCCCAAACGTCAAGTGCTCTGCCACTTCGTGCAGTTTGCGCTGCGGCG
CGAAAACGTCTTCACACGGAAGCGGGAAGAGGAAGCCGAATTGTACGTGCTCGGCGCGGTCAAAGAGCGCCGAGTCTACGGCGTCTATCCAGTGGATAGA
GCGGAACTCGATCCGCAGTCTGAGCTCGCACGCACCCGGCACGTCTTTCATTCGGGAAGCAGCTAGTGTACCCACTGAAGGAGCGCGGAGGATCATGGGG
TTGGCATCCGTCGAATTGGCGTTCCACAAGCCGTCTTCCGCAAGAAGGGATACCGGAGACGCTTTCTGCAGCGAAGCCAGCAGTACTACCTCGAAGCGAG
CTGATACCGGCTTGTGGTCCGACGAGGTCACAGCCTCGCAAGAGTCATAGGACAAACAGCGGAGCGAATCCTGCATGCCTGCGAGCGAGCTATAGAAACT
CGATTCATACCAGTGGTCGGACAATTTAGTATTGCAACATGGTTTAAGCAACAATTTAATAATTGCAATACGAGTCGGGCCAATAATAAATAATTACTCG
GGTGGAAAGTTTTGGGGTGCCAAACCGGAGTCCGCTTTGATCCCGCAGGTTATTTCCTTATCATGTGGAGATGATATCGACCAACCAAAGGCCTTCGCTG
CGCTTGGCTATGTTGTTAATGACCAATGAGGGCCCGTCTTCGACGGCTCGGATTCTTTCTTGCGAATCGGAGCCGCCGTCGCTATCTCTCGGCAGCTGGG
CGACAGACACTAACGGACGGACCGGTTCTGTTGAAACCCTCGGATCTAGCGTCAGGATCCGGGGGTGTGCCGCTCAGCTGTGATCTGAATGGCGAAGGGT
AATAAGCGATAGCTAAATATAGGCTAGGGACATTGCAGAATCTCAATTTCCATTATACTCTGAATCGTGCACTTCTAACAGGTTTTGAGCCCAAATGCAA
GCGGAGCCAGGTCGCGTAAGGACCGGCTCCAAC