Description :
From Genome Similarity Track
Location :
Scaffold_459:33- 5167
Transcript NameFunction/comments
g14460.t1hypothetical protein

Sequence
5134 bases(100 bases per row)
ACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAAC
CCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTCTCAAATCTGGTCATCATTTTTGACCGGATATTAGGTTTCATAAAACTGTAAAGT
TACATACCTGTCAAATCCGATCAATCATATTTGACGGGTTTACGTATTTCAATAGTTTTATTTTAGTCATTTTCGACCCTTTCATAATTGTTATAACCGT
GGTAACTGATATCATATATAACGGGATATCAATATACACAGGCGCCCAGGCACTTAGTAATTTGACAGGGATGCAGACCGAATTTCGCAACTTTGAAACC
GGCTTTGTATACTAAATCGACTACGCTGAGTTCGATTCCGTTGAAAAATCAAACTTTCTGAAGCTCAGTTTTGAGATAACAGGTTTTTTGCGTTTAATAC
AAACTTCCAGTCAACTTTTGAAGTTCAAATTTTGGCTGCAACTCTAACTCGGTGAGTTACATATGTGTGCAAAGTTTCAGAAAGATCCTGAAGCTAGTTT
TTCCAGGGACCCCTCTACTAAACCCTAAACCCTAGAAGTACCGTATCTTCTCCATAACATAATACCTGTCTAATCCGATTGATCAATTTCACAAGGATAT
ACGTTTTAATATTCATTTTGTCACGTCCAAAAACCTTGTAAAACTGATGCCCTGTCAAATCTGTTCATCGTTTTTGACGGGATATCAAGTTTCATAAAAC
TGTAAAGTAGCATACCTGTCAAATCCGATCAACAGTTTTGCCGGGTTTATGTATTTCAATAGTTTTAATTTGGTCCATTTTGACCCTTTCATACTTGATA
TCACCTTGGTAACTGATATCAGCTATATCAGTATATCAATGTCCACAGGTGCCCAGCCACTTACTAATTTGCCAGGACAAATGTTCATCCGGGCGTTAAT
TTGCAAGATTGGATCTAAAGATGCTCTTTAATTGTAGGTCAACCTCCACCGGGTATCTACGCTAATTTGAACCAATCACAACACTGCAGCCTCCACTGGA
TTCCGTGTAGCCTCCACCGGATTCCATGTCAAACATGCAGTTTAAATGTCAGTTGTGCCATTTAACTGTCATTTTGCCTCCACAGCCTCCACCGGATTCC
AGTGCAGTGCGCGTATTCTGTATACAGGTTTAGCGGTTTAGCGGTTTATTAAACCCTAGCGGTCCATGGTAGTACAGTATCATCTCCAAAACCTAATACC
TCTGTTATCCGATCAATCATTTGTTACGGGTTATAAGGTTTTAGGTTTACTTTTTTCATATCTGGCATAATTTTTGAAAACCCAAAATACCTTTTCAAAA
TCTTCAAAATACCTTAATTTGGGTTCCTGGGGACCCGGATGAATGTTCTGGGGACCCGGATGCCTAAAATACTGGGGGTTTTGGGGACCCAGGGGACCCC
GGATGAACGTTCATCCGGGCCACAATATATATAGGCGTACTCGCTGCGCTCGTCTCACGTGGTTCCCGTGTGTACGAACCCTAAGCCCGCTACGGCTCGC
AAGCTTCGCCTCCGCTTGTCTACCATGCACTGTTTGGTCCTGGGTTTTCACCCGCGTGCTTCGCACGCGGACTTCAAACCGCAGGCGTGCTCGCTGCGCT
CGAGGGGGAATGGCGACTCTCAACAATTACCGCTATGCAAAGTGACAAATGTATTCCTTTCGTAAAATATGCATTCACACGAAGTCGCTGCCTACGCCCT
CTCGAACAGCTGTCGGTACACTATGTTCGCCGTGTACACTCCGTCTTCTTCCTCCCGCTCTGGATACTCGACCAATGCCTTGAATCTCGACCTCGACGTA
ACCCTTGATATGGCCACATACAGCTGACCGTGGGAAAAGCAAGGAGTCGCCAAGTACAGTCCCAGGTACTGCACCGTTTGTCCCTGCGCCTTGTTGATCG
TCATGGCAAAGGCATTCTAGATAGAAAACTGCCTGCGTCTCAGTCAAAATGGGAAATCGCCTATGTCGCCATCGCTGATGAACACGATGCGCGGGATCAA
CACATGCTGGCCTTGCCTGTCGCCGGCCATGATGGTGGCATGGATGACATGATCTTTGAGTTCGACGATTCGCAGGCGTGTTCCGTTGCACAACCCCATG
TCGGGATTTAAGTTCCGCATCATGATGATCGACATCCCCTTTTTGAGTTTCAGCTTGTGGGGTGGGATGCCACTGATGTTCAGGGAGTTGAGCACCTCCT
GCTCGAATAAGTTCCCGTCCTCGTCATCCTCCACTGAGTCTGTGGACACATATTCTCGAGCTGGTCCAGTCATGCGATCCGCTACGGCTTCGTTGATACG
ATGTACTATCGCGTTCGTGGTGGTGAGGATGGTGCGACTCGCAAAGTACTCGTCCGTTGCGACTTCCGAATTGTTGATGTCGGCGTACATCTCGTCGATC
ATGCGCCGCATACCTCGCGGAATAGCTCCCGGTCGGATCTCCTCGTCCTCATCTGGATCACCGGCGGGGTTGTCGATGAGCATGTCGCGTGGAATCTTAA
TGTAGTCATTTCCCAGATCGTTGTGTACCTCGTGTCTCCCCTCTCCAACCTCCAGCAGGTACTCGGAAAACGCAGCCATTTCTGCAGCACTATCGGACGT
GGCAGCCGTGCGAACACGCATGTTCTCTGTCAGACGCACCTTAAGGAAAAGTGGCCACAGTTCGGATGACTTCAGGCATGCGTCGATTGTCTCTGTAGCC
GAGCCGCCCTTCACCACGGGGAGAATTTGCCTGAAATCTCCCGAAAGCACAACGACTTTCCCACCGAAAGGTTCTGCCTCGTTATCCAAAACGTCACGAA
GCGTTCTGTCCACTGCCTCAAACGCGTGCCGATGCGCCATGGGTGCCTCGTCCCAAACTATCAAACTTGCTTTCCTCATCAATTCAGTGACCTGGGATCG
CTTGTTGATGTTGCAAGTAGATTCGCCGTCTATCTTCAAGGGGATTTTGAAGGTAGAATGCGCTGTCCGACCTCCCATAAGCAGCAGAGAAGCAATCCCA
CTGGAAGCGACCGCGATTGCAATTTTTCCGGATAGACGAACCTTGGCCAGTATGTTCCGAAGCAGTGTCGACTTCCCGGTACCGCCTGGTCCATCAACGA
AGAATAGCTTCCTGCCTTCCTGTGGGTCCTCGACAGCTTGGGTGATCTGATCATAGGTGAAGCGCTGCTCCTCATTTAGGTGGTCCTCCTCGCTCACAAT
TTGTTCAAGAACAGACGCGTCATATCCCGTTAGCTCTCGTCGGATGAGATTGTTTTGCAGAACAGACTCAAGCACCAGGCGAGGGAACTCGCTCAGCCGA
GGGAGATCAAAGTCTTGGACGGAGTACCCACTGACACTGAGCAAGTCTTGGATACTCTTCAGTGTGTCGAACGTCACAACAGACGTTTTAAAAGGGTCCA
ACATCTCTCGGTTCCTGTACGCATAGTCAAGCGAAAGGTCTTTGAAGAATTGGTCCCAAAGACCCCGAACATCCGTAGGCGCCGAGTAGACCAAGATTGT
TGCAAAGAGCTGGCGCAGCTGGTACGGCATCTGGAACTCGGCAGCCTCCGACAAACACAAAACCCATTCGCTGTCGTTCTCCAGATAGCCGGCATGTTCA
GCCGCGTCTCGATACGTGGGACACAGCACACCATCAACTGTCCGCAGGTCTTCGAAAGACCTCGGTCCTCGGCGATGGCATAATAGCAGGCGTAAATAGA
AGCGCTCCATATCACGCGGTGAAACATGCACCATCCGACCAATTGCAGCCTGGTACCTTTTACGTCGAACCCAGCACTTCGTGTTTCCCATCCAGCGAAA
TTCCTTGGGTATATCCTGGTACAGCATTGTCTTCGCGATCTGGTTCTCGGGTTCGTCGCTCGCACACAATTCGAAGAAGCGGGTCAACATGGTGTGATTC
CCACGACCAAGGACACGCTCCGGGTCTTCCGTCGCTCTGAAGAACACGGTTTGGGCATCTTCGACGTGAACGGTAAGCTGAGTGACTGCGTGTGTCTTTC
CTTGGATCAAGAAGTCGAGTAAGCGGATACAGGCTTCAACTGGAGATATGTACCTGGCCGTGAGGAAGCGCAGAATCTCGTTTGGCTCTTGCCGAGGGAG
CTCTCCACCCGCGCGAACTGCCTCGACAGTTAGCACATCTTTATCGGACCCTTTGTAGACGTACTTGTATAGATATTTCACAGCTGAAATATCCGTGCAC
ACCTCGACGTTGATGTGGCAATTGTACTTTTGGGATAAGTACGGGTTGTACGGAACAACCCACTGGTTAATAGTGGCGTTGTCGTACTCTCTGCCCTTCC
ATACCAGGACGCCTTCAGCTCGTCGACGCCGTCTGTAGACCGGATAGCCGTTCACATTGGTCCTTGTCGCCTCTGCAAAAGGTTTCGGATATCCTTTCGT
ACACTTCCCGTCCTTCATGCAAGCGCATGACGGGTTTCCCGCTCCACAGGGTCCATGCAGCATGCATGTCATGATTGTCTCGAATAGCTGCGGGAACTTT
TCTCTGTCAGGAAGCTCTGCAGACACCATACGATCTACGATTTGGCGAGTACGTGGCTTGTCCTCTTCAGCCAAAATGATCAAGATGTGCGCGTGAGGGA
GCCCTCTCTTTTGAAACTCGACCACGTAAATCCGCGCTTCCATACGGCCCAGCACTCCTTCGCTCAGGTCTTTAAGCTGAGCTTGCAGTTTTTGCTGCCA
GACACGGGCTACAATATCGGGGCGGTCCTGAGCGTTTTGTTGATCGGACCCAAGGGCCTCGACTATCTCTTCCCATGTAGGGCTGCAGGTCGTTGTCATG
AACACATCAGGCTTGCCGAATTCTCTAACAATGGCCATTGAGTCTTGGTAGGACTGGTACATCGCTCGAGGACTGCCCATATGAGATGAGGGCAGAATAA
CGCGGCGTCCCACTTGGTTGAGAAAATGGGTATCACCACCACGGCCTCGATCAGGGTGGACCAACGTACCATCGCCTCTGTCAAACTCGGAGAGTAGCCC
TTCGCCTGCTTCCAGCTGAATTGTTCCTTCGTTC