Description :
From Genome Similarity Track
Location :
Scaffold_678:33- 4275
Sequence
4242 bases(100 bases per row)
ctcggctgtggactccgtgcgcgtcttctgatcgccgctagttagcccttggttcttggcgctctctcgacgtcgtagctgagttgcctggtcttctggc
tcacgctagctcggtacaactcggctgactggtacagtgtactcacccagccgagtagaaccgtcagtttcgcttttggctgtcttggtaccttgttcca
cttgggtgctccacaaaactgatgtttcctacaccataACTGCCCCAGCCATGTTACGAGCCGGAATGGTGAGTGACGTGGCTCATCTGGTGTGTCCCAC
ACGAACTTCTCCCGTCCAGTCAAATTTGTCGCTCACATTCCCCAAATCGAAGCTGGTCGGAGCGACCGGAGCGCGACCTCGGCTCCCTCGCTCCGTGAAG
GTGAAGCCTTCGAATGACGCGACCCTTGGCTCACACCTTGTCTGACATGTGGTCTCTGTGCCCCACTATGTCTGTGCTGGTACCGATGCCTCTGTCGATG
AGACCAGGCACCGCCGTCCGGCAAAATCAGTGTTCGGTTGCCAGCTCCTTCGCAGTCCGTGACGGTCCCGGCTTGACGAGGTGATGTCGGCTAGCACCCC
CGCAACTCCGCTAAGCTCGACCGGGATCACTTTGGACACGTCCTGTCGAGATGGAACTCGGCTGTGCGAGGCTCCAGCATGCCCTCGCCAACGTGGAACT
CGGCGACGCTCGGTCGAGCCGACTTCGACACGTCTAGTCGAGTTGGAACTCGGCGGTGTGAGGCTCCAGCATGCCCTCGCCGACGTGGAACTCGGCGACG
CTCGGCCGAGCCGACTTTGACACGTCCAGACGAGTTGGAACTTGGCGACGCTCAGATCCAGCGCGCTCCAGCCTACAAGATCGAGCTCGGCGACGCTCGG
CTCAGGCGATTTCAACACGTCCAGTCGGGTTGGAACGCGGCGGTGCGAGGCTCCAGCATGCCCTCGCCGACGTGGAACTCGGCGACGCTTGGTCAAGATG
CATTCGACACGTCCAGTCGAGATGGAACTCGGCGGCGCGAGGCTCCAGCATGCCCTCGCCGACGTGGAACTCGGCGACGCTCGGTCGAGCCGACTTCCTG
ACACGTCCAGCCGAGATTGGACTCGGCGACGCTCGGCTGAGGCGACTGCCACACGTCCAGTCGAGTTGAAACTCGGCGGCGCTCGGCTCCGTCATGTTCC
TGCCGACATTGAATTTAGCATCGAAACGAGTCGGCACCACGTCAACAAGGTTCATGAACTTCCATTCGTTCATTACGGACCCTCCGTTTCTCAGCGAACT
CGACTTCCTCGGCTGGTACTTCGCCTGCATCGGGTACGGCATGCTTTCACTCcatgcttctcgactcaatctccactaaactccatttcggtatcatgca
atcatataatcatacagttgatgcagtgtccttcatcgttccgactcggcctgctgtcttcaccgagtcggcggatcatcatttggtgcaatagctttag
ttcacatccgcaactagcaccaattgcagacggatttcacgtgtcttctattgcagacaatcgaatggcaaagtgctccacgagatgtctgacaacagtt
cccaattcggGCTTTTCCCACTCGATGCcctcgtcgctctaagtaataggggcggacggtcccctggagcaacgtcttgaatgtcgtcgtccgcNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN