Description :
From Genome Similarity Track
Location :
Scaffold_342:33- 3447
Sequence
3414 bases(100 bases per row)
TCACCTATCCCAACACAATCTTGGATCCGACTCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCTGGTATCGACACCTTGGCACCACTAT
CTGGGAGTAGGATTACTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCCGGGGCATGGTACTTCCAGTACCCACGGGACTC
TCCTGTTAGCAGATCCATGGATCCAACATCCTCAGATCCATAGGATCCAGTGACCAGACAGACCTTAGGTGGATCTGCAGTGACTTCACCCTTGGTAGGC
TCAAACCATCGACCATGTTGGCGTTTCTCCCAATAACCACGTGCCTCTCCTCTGTGTAGATCCAGGGTTGAAGAGACTTCGGATCTGGAAAACTCATCCA
CTTGGCGCAAACTAGAGACCTTGGCAACTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCTT
GTTCACAAATGCATAAATGCAATACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGGCCACTTCTGGCA
ACATCCCTCTGTGCTTGGCTGGATCAAACCATTGGCGGATCTGGTTGTAGAATTCTTCCATCGGACACTTGCCGACGTCGTGAATCTCGCCACACCCGCG
ACACACGTAGAAGCAATGATCTCCGGGATGACCTTTCTTGCCTCACTTCTCACAGACCAGCTGTTTCCAGCATCCAGATTCAGTGTGCTTCCGGGATCCG
CACTGCGAACACCTGACCTGGGCTGTCCCGTCCATGAGATCTCGGGATCTGTACACCCCACGACGGTATCCCTCGGTCGAGAGTTGTCTCCGGTCTTCGC
CGTTCGATCGTTGGACGCAGTGAGACAGACTCGACGGTAATCTTCAGGGTCGGCGTCCGAACCGTCGGATCCTGACTCAGTTCCTAAGTCAGGCGCCGTG
ACTTGGTGGACACGTCGAGCTGGGGCCGTGGGCGTCGGAGCCTTTTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGAT
CCACCGCCCGCAGCACTTCCTTAAGCTCATCTGCGTCTGGAAGACGTAACAGGGTCAGCCTGTCGGCCAGATCCACATCTCCCAACGTCTCGATGAAGTG
ATCCACGTTTTCCCGCAGTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGTAGGTATTCCAGCGGGGAT
TCATCCGATCTGCGGCGAGCGTGGTAGTATTGTCGTGCCACCGACACTCCCAATCCACAGTACTGGGTCTGGAAGCTGCGCAGCAAATCTGGCCACTTGT
TCCTGGTGGATTTGCCCAGCTGCCGATACCAGTTCCTGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAAACACTTCTCAGCATCCGACGCTTGATCTCT
CATGAGGGCCGACTTGACTTTGCTGATCCATGTTCTCGCTCGGTCCTCGTCTTGATCCTTGCCCGTGAACTCCTTCAGATCCGATATGGCTGAGATCCGT
ACCCTCTGGATCATGGACGATCCACCTACCCCGGCTGTGGCTGTTGCTACCACTGCTGACGAAGTGGATGGGCCATCCAGATCATCTGGGTCGAACTCAT
CATGGGAGTTGTCTCCCTCCACGGACTCCGTCTCCACGTCTCGTGCTCCATGTTCGTGGAGCACTTGCACTTGTGGCACGGGCGCTCTCATACCCTGTTC
GGCCAGGAAACGACTCATCGCAGCTTCGAAGTGTCGCTGCAGGGTGCCCGAGGAAGTGTCGGAAGAGCCTGTGGCCGTCTGGTCCACTGGCGAGACCGGA
TCCGTGAGGCGAGTACCTTGAGCCCGATCTGACGATAATCCCACTGGTTTCTTGTCGGATCTGGCTCGATCGTGGCTGGATTGTGTCAGATCACGCGTAG
GGCTTACTGGATCCGGAGCCTTCGCGCTCACAGGGACTTCCTGTCCTCGGCTCCTCACCCGCGCTTCCAGCATGGATGCCCCGGAGGGTCCTAAAACCAT
GCGTCGTGGTTCGGACGACGTGTCTGACTCATCCTCAGCGGCGGATTCGTAGTTCGAGGATGCAGCTTGGCTGACCCTCGGCGACGACACCGGATCCGTA
GTGCGCGACCTTTCTCCGGTGCTGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGCGGATACTATGAGATCCAGGTCTAGCTCGAAGATATCCTCTGCGT
CGAACACACCAGCTACGATGCCTGACTCCGTAAGCAAACGTAATAGATCCTTGACTGCCACCAACTTGTTCGCCGTTTTCGTTGGTGCTCTCACCGGTTC
TCTTGGATCTTCGATCTGTCGTGGATTCAGGATCTGCATGACAGGATCTTGATGCAGGAAGTCGCGTAAAGCTTGGTGGCGATACACAAACTCGAGATCC
TTGTCTGACCAGCCAGACCTGGATCCAGCTTGGTCTTATTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTTCGTCTTCTTTCTCG
TTTCTTAGACTAGCGGGGTTGGGTTTAGGTACAGTGTTGGCTTAACCGGTGAATCTGCAAATGCATACCGTTTCGCCTTCACTTTTCCTTGTTTTGTTAG
CAGGGGTCCCCGAGGGGACCTGGGGAGGACAGAGAGGTTTTTCTTCTAGATCCGGATCCGGATCCACCTCTCTTCTGTCGACAGAGTTCCTCCCAAAACT
CCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACTTCCGACGACGCCTCTTCCCCTGGCTCAATCTTCACTTGAGCATCTTCT
TGGGACTCACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTGGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCTGGATCCAAC
TTACCAACTGCGCCCAGACACCGACTAACGGAGGGGGCCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGA
TCTTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGAAGCTTGAGTGTCTGGCGAGACGTGGGGATGGGGTGGAGCAGCAGTGGAAAATCTTCACTC
TGCGTCCGTGGATGGTTCCGAATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGATTCGTGGATCTGGGGCGTAGGGGTAGCCTGTGGGTGTG
CCCCTTGCCTTTGCGTTTCCTTTACGTCGTACTTGCCCGCCTCCTGGGACGGGAGATCTTGAGAGTTGAGACCTTCTAGGGTGTAACCGACCAAGTAGTA
AATTCGGTTAACCT