Description :
From Genome Similarity Track
Location :
Scaffold_1163:33- 2473
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1163-fgenesh-gene-0.0Nucleic acid binding protein
Pytiw_DAOMBR242034maker-piw_contig_1163-fgenesh-gene-0.1Conserved gene of unknown function

Sequence
2440 bases(100 bases per row)
GCATCATGATCTTGGGCGCCGTAGCGGGCGTGACCGTCGACTGCTGCCTGTCCGAGGACAAGTCGATGAGCAGCACGCTAGGCACGATGCTCTGCGAAGT
TCGAAAGAGCGTCACAGCGCGTGATGAGTTGCCGTCATAGCCGCCAGCGGCGTACGGGTTGTACTCGGCGGTCTGGTGCTCGAGGCAGCAGCGCTCGGCA
AGCCTGTGGATGATCAGCCGGTGGTACGACGATAGCGGCGGGAACACGAGCTGCGCCTCGCGCGCGGTCTTAAGGAAGCGCACGATCTGGTCTTCGAATT
TGAGCAGCGTGAGCCGCTCGCGCGGGTTCTCGAGACACGCGACCAGCACAGGGTCCATGGGTCCGCGGCCGCCATCAGAGGCCGCGGCAGCGCTGGCCGT
CGCGGCGCTCACGGGCTGCACGTGCGCGTTGCTCGGGTCGAAGGCTGCGCGCTCATACACGCCTCCGTCCTGCGGCGGCAGTGGCGGCTGCATGAGGTGC
ATCTTGCCCATGGCCTGCGCCACGGCCATGGCGCGCGCGCTCGGATCGTCCTGGGTTTCCCAGTCGTCGTCGCTGCCCGACAGAGAGGGAGCAGCCGCAT
GCAGCTTCTTCTCTTCGTCCTCACGCAGCATCCTGTTGTGGTCGAGGAGATGCGATGACGCAATCCGTGGTCGAGTTTCAGTCTGCGAGCGGATCGATCA
CCGCCGTGCGGGTGAGGGATCTGCGTGTGGCGTTCGCTGGAAGAAGAGCAAATAGATAGCAGCGTTAGCTTGTACGTATAAGAGGTGGCTAAGTGCATGT
GTGTGTGTGCCTTGACAGCTCGTAGACGCGCACGTACGTCCAGTGGCTCCAGCGTTGCGATGGCGGTCGATGGCCTCGTCCTGGAAAACTGTAGCACCAC
GAATGGATCACCCGCCGTGTGTTTACCTGTAACAATAAATACTGTCTATTTTATGAGGCACGAAATAGCTTCCAGGTTTAAAAATGAGTGAAATAACGAA
AACACTTTTCAATTCAAAATGCCTCGAAAGTATTTGAAATGCTCCATTTTATGTTTAATTATGATACCTCTATGTTTGTATACTCTGCACCTCTTCTATT
TTCCGCCAATTGGAATCTCGAGCTCTCCCAAATAGTCCCCCCGTGGGTGACAGTATTAATGATTAGCGCGCGCGATTTGTTTGCTTCCTCCTAGTGAGCA
AGATGATGCGGACGGGGCGAGTGTTCGCGGCCCGTCCTTCCTACCTGTTGTTGTTGTTCTTGTTGCCGGTCACTCTCTCTCTCGTCACCACTCTTCCCAC
TGTCGCTGCTTGAGACTTGTGTCGTTATCTCCCACGCCATTTCACGAACAGCGTGACCAACGCCCTCGTCACCTTCCATCTCTTCATGACGACAGCCGCA
CGAGAAGCCCGGCTAGGTCGTCTCGGTCGTTTGGTCTCCGTGGGTCTTGGGTCGGCGGTGGTAACTGTGGTGGTAAGACCGCTGCTTCCGGTCGGCGTGC
TTGAGCGTCTGGCTCAGTGAGCTGATCTTCTTCCGCGGCAGACTCAGGTCGTCGCCGTCCATGTAGATGCCGCGGTGGATGTCGAGGTCTCGGAGATGCA
CGCGGTCGACGTGACCTGCAGCAAGCGGCTGCTGAGCCACGTGCGGTAGTACGCGTAGACTCGGTCCTGGGCTGCCCTCTTTGTCGCCCTCGTCGACTTG
ATCATCTCGATCAGCATCATCTGAACCAGCTGAAACAGCACTGCCGCTACTTGCTCCGCTGTCTGCGAGCCCATCCTCTTCGCCATGCTGACTCTCCTGG
TCTTCCGAGACACTCAGCCGGCTCGCGCTGTGGTAGAACTTTGACAGCAGCGTCTTGCGGATCTCCTCGCGCTGTGGGTGCTCCTGTTGGATGACGCGGA
TGCGCTCCATGGACGCCTCCTCCTGGCGCCGCAGTCGGTCGTACTCCTCGGCCTCCTGGGCCTGCAGCTCGAGCGCGAACGTGTAGTCCGGGTCGTCTCC
GCCCGAAGGCCGCTCGTCCCTCGGGACCTCCTGCTGGACGACACTCATGACGCCGTACTCGCAGTCGGCGGCGCTCGGCACCTCGACGAAGCACCAGCCG
ACCTGCCGGTCGTCGCCGAAGCGCCCGGCGATCTCGAGCTCGAACTGCTCCTCCTCCTCGCGCTGGAGCTTGGCCGCGAGCTCCTCGTCCATAACGTCGA
AGAGCGTCACGCCGGCGCCGCGCACGGCGGCCGCGGCCACTGGACTTCCCCACGGGTTGCGGCTCATGGCTCCTACCTGCTGCTCTGGGCTTCTGCTTGC
CTTGCTGGTTTCAAGGCTGCAAGAGCAGAACCCAGGACAACCACTCCGTAGGCCACGTAAGAGTGAGTGTTGGTCCCGCTTCTCTTTCGACTCACAGTCC
CATACAAGAAAGATGGGACTAGACACAGTGAACAAAAACA