Description :
From Genome Similarity Track
Location :
Scaffold_4450:33- 2207
Sequence
2174 bases(100 bases per row)
ACGCGCGATACGTATCGGCTTCGGAGTCGTGCTGGCGGTTGCTCGAGTTTCCTTTGCAAGAACGGTCTCATAGTGTTACAAAGCTCCAGGTGCACTTGAA
AAATCAGCAGACCGTGGTCTATCGTGAAGGCCAGAACTTACAACAAGCGCTGGAGAGCAGCAAACACACAACACTGCTTGAGTTTTTCGAGTTATGTAGA
CGCGACCCCGACGCTCGAGAGCTATTGTACCAAGACGTTCCCAGACATTATTGGTCGTCAAACAAGCGTTGGTGCAAGCACAAGAACAAGCTTGAGGCAG
TTGGATGGATGGTGACATGCACTCCGAACACAGATCGTTTCTATCTCCGCATGGTTCTGTGTTATCGGCGTGGGCCAACGTCATTTGAAGACCTACTCAC
AGTGGATGGTGTGCAACATGAAACCTATCTTGATGCTGCTCGAGCGATGGGGCTCCTGGCTGATGACACGGAGTGGCAACTATGTATGCAAGAGGCAATT
GCATTTCAAATGCCAAGACAGTTGAGACAGCTATTTTCTGTGCTCCTTCTCAACAGCGACATTGCGAACCCCCGTGCGCTGTGGGATGCGTTCGAGTATA
ACCTTCGCGAGGATTTCCATCGATCACATCGCGATGCCTACAGTCGCGTGGAAGATACAGAGCAAAACTCCAGATTGACTGCTGTCGAGACACTATTAGC
ACTTGAAGACATCGACACGTACCTTCAAGGTGGTGGAAGAAGTCTGAGAGACTTCCCGTCCCTCCCTCAACTTGACCAGTTTCAGCATGTCCAACATGCG
CGCAGTCGTCGCAATCGGCTTATCGAAGCAGAGTTATCCTATGATCGCTCGATGATGGAAGCATTGGTTGCACAGCCAGCACTCGACGCTCTCAACGAAG
ACCAGCGTACTGTGTACGAGGAGGTTGTCTCAGCTGTCGCGTCGAATGCAGCAGAGCATAAACTGTTCTTCTTAGATGGCCCAGGCGGTACGGGAAAATC
GCACGTGTTACAGAAAATCTTGGCAGCAGTTCGACTGAGTGGGAAAATTGCGTTGGCGGTCGCTTCAAGTGGCATTGCGGCCCTTTTGCTCACTGGCGGG
ACGACTGTGCACTCAACATTCAAGGTCCCAATTCAACTCTTCGAGACTTCGACATGCAATGTAAGCGTTCGATCTCATGTCGCCCAACTACTGCGGAAGA
CCGAGTTGATCGTGTGGGATGAAGCACCAATGATCCACAGGTACGCCCTCGAAGCCATCAATCGTACCCTTCAAGACGTCATGGACAACAGCCTCCCTTT
CGGAGGGAAGGTGCTCTTGCTTAGTGGGGATTTCCGCCAGACATTACCAGTAGTCAAACGCGCAAACGCTGCTCAGATCATAGAAGCATGCATCACGAAG
AGTGAATTGTGGCCGCTATTTCGGCAGCTCCGGCTTACGATCAACATGCGGGTTAGACGCGCTGCTATCCCGAGCGAGGTGATGGAGATTGAACAGTTCA
CGAACTTCCTGCTGCAGATTGGCGAAGGAAGGCATGAAAGACATCCTGATCTTGACCCTGAGTGTGCTAAGATTCCCAAGGATATGGTGTTCGAGCCGAC
CGATGATCCTCATCGTGATCTACAGCGCCTCATTGACCACACATTCCCTGACATCCGTCGAAGATATCAAGAGCCCCAGTACTTCGCATCTCGAGCTATC
CTGACCCCAAAGAACGCTGACGTGGAAGCTATCAACAACAAAGTCATCCAGGCAGTTCCAGGCCAAGTTGAGACGTATTTATTCGTCGATACGATCGACA
ACGATGATACTGACGGCGCACTCCATCTCACCGACGAGTTTTTGCACTCTCTCAAGCTTGGTGGCTTGCCACCGCATGAGCTTCGCCTCAAAGTTGGGAC
ACCAATTATTCTGATCCGCAATCTTAGCACTCGCAACGGACTCTGCAATGGTACCCGACTGCGTGTTCTCGCCCTACGACCGCATTGCATATTGGCGAAA
GTGATCACAGGGCCGAACGAGGGGCAAGAAGCTCTTCTTCCACGGATCAATTGTGACAGCAGTGAGAGTGCTCTTCCCTTCACTCTTCGGCGACGGCAAT
TTCCAGTTCAAATAGCATTTGCTATGACCATCAACAAGGCCCAGGGCCAAACAATGAACCACATGGGACTCTAC