Description :
From Genome Similarity Track
Location :
Scaffold_305:33- 1553
Transcript NameFunction/comments
Phypa_INRA-310PPTG_20091hypothetical protein

Sequence
1520 bases(100 bases per row)
CCCGTGAAGCGTGTTGTGATCTAGTTAGCTAGTTGGGAACAGTGGCTATATACACGCCGCGTACTTCCTGGCAGCTTGGATCGCGCTAAATGGAAGTTCA
AGTACTCGCCTACGGCGCCGTATGGAATCAACGAGTGTTTCCACGTGTGGAGCTTTACGGATTCGTTGATCGCTAGTATCGCTGTGTTGCAGTAGCTGCA
GCTCCTGTTAACTTTATCTACTGCACAGGTATGATCATGCATCCCGTACATGGACAAAATTCAGACGTACAACAAAGGCTTCTCCGACATCATGTCTGCT
TCATCGAAGTACAGATTCTATCCTAGTGCATTGCTGTTCATTCTGCTGTCGACACTGGAGCGGTCTGTGACTTTTGCTAAGTGCGTGGTCACGTTCAATG
TAGTTTTGCGTGGCAGCATTGGCGACGACACCACTACGTATATGCTCAGCTCTGCATTGGCTTGGGTACGATCATCACTGGATTCTTCAACTTCTCTGTG
GTCGTCGGCTGTGTCCGCTGCCGGTGGTCGTTTCAGCACGTTTTTTGTGTTACCAACGACGACTGCCGCTCGACATTGCTGATGCCTGGTATCGGTCTGC
TTGGCAACCCGTGTGGTATTCCACGATCATGGCTGCCCGTCTACATCTTCGAGATCTCAAACAAAAACTGCGTGGTATAGCTATTTTGCTGCTGGGCTTT
GGCTATTGGTAGTTCACTTGGGGACGTGGGATGTTTTCGTTATAATGAACTGGAATGGATTTGGCATGCGCTTGCTGGCTGCATTGTCATCGCGTTGGTC
ACCCCATAACATGTATTCAAGTTCCTCGTTGGTTTCGTCCTGATTCTCGGATCACATTTGACTACTGGTTTCCTGACCGTCTTCGTTACTACAAGGCTGC
TAGTGGTACGCTGACAAAGACCGGATGTTTATGATTGCTATGGCTCTGCAGGTGTCGAGTGCTGCGATCACCATCCTTTATATCGACAAGCTGGAAAACA
AGTCGCTTATGTTCGAAACATTTGTTGCTATCGCGATCTGAGCGGGTAGTACCAGCTCCGAATTTTCGTTGAAGTCCTAAATACATGTACCAGGCTGGTA
CATGCATTCAGGATTTCAGCAATAAAATTGGGCGGCTTGTCGACAAGGAAGACTCTCGAGGTAATGCGCATTTAAGTTTTTGCGGCCTATTAAGAGCTCC
GCCACGTGATCGGCTTGTATCGTCTTGTTGCACACTCGTAGCTTTGACTCATACACTGCAATGCTATTCTCCACCTTTCTTTGGTGGATCTGTGCTTCTT
TTACTTCGAAATACATGTATACACGCATAGCGAGCGAATATTTCTGCCTCGCGCTACCGCAGGCTTCAATGCAATCGCATTTAATGCTGTTGGTGGGCAA
GGCTAAAGCTTAGCGCAACCGCGTTTGCTGCGCTCGAATGCGTGCCGAACGTGAAAGTCACAAGACATAAACTCCTGGAACTGCTCGTCATCGAGATCTT
AGTCATGTGAGGTCCAAGTC