Description :
From Genome Similarity Track
Location :
Scaffold_758:33- 1361
Transcript NameFunction/comments
Aphas_H257_19538transmembrane protein, putative

Sequence
1328 bases(100 bases per row)
TCGTTCTGGGTCACCCTGAAGTACGAGTTGATGTACCGCGTGAGCATGCCTGAAAAAGGAGACGCCAAGTTGGACACGGTCGTGACCAAGCCAAAGGTGG
CCCCTTCGTTGCCCACGTCGGCGATCTCCACGGCGCAGAACGTGGACACGACAAAGCGGATGCCCTGCGGAACTTGCTCCGACAACGCCACCCCCGTGTA
GAACCACTGGTTGCGGACGATGTTCCAAATCGTGAGAAACGTGGTGATCGAGTCCAGGGCCAGCACGGACACGGACGCAATGGCAATCGACCAGCGCCAG
TTCCAGTGCAACCCCCACTTGGCCACGACCATCATGATGCCAGCAAAGATGCCGCTCGCAATAATGCCGGCCAACGAACTGTTGAGCGGCTCCACTTTGG
CCCACGTACTGGCCATGGGCGAGTCCGCCGTGGAGCTGATGTTGCGGAACACTTGGCTGATGAACCGGAACGCGCAAATCTGCCACATCACACGCTTCTG
CAGCAACTCCCAGAACCCCGACGCCCACACCCGGAACGGAATCGGCGGCGTCTTCTTCTCTTCCACGATGAAGATCGTCGACAACACCACCAGCACGCAA
GGAGCCAAACAGATGCCGTACGGGACGTTGGGACTCATGGAAAACGAGAACGACCCCAGGTAGTTGGCGCCGTTCAAGCCAAACCCGACCACCACGTCCG
CCATAATGCCGAAAATCGTGCGCACCGTGTAAATGCCAGTCAAGACACGGCCGCGGACAGCCAACGGCTCGCGCTGCGAGTACTCGGTCACCATCGCATC
CGATGCACACACGGCCGTGACGTACCCCAACGACACGATCATGGACAACATGATGAACTTGGTGCCCTGGTCCGGAGCGCCCAAGTTGAACAAGTCCTTC
TCCTTCTCCGACGCACGCGAGAAGACGCGGGAGCACGCCGTTGAGTTCATCGCCTTGGCCTTAACGCGGTCGCAGTACGGGTCCCCCAACGAAGAAAACG
TCATCACAGTCAAGCAGATCATGGTCAAGGTCCACCCAATCAACATCCACGACTTGCGGCGGTAGCCAAAGATGGGAAAGCAGTCGGAAAACAATCCCAT
AAACACCTTGAACGACCAGCCCATGGTCACCAACTGACTGTACGCCGACGTCTGGTACCCCTCCAAGTTGAGGTACACGTTGAAAATGGGGTAGTTGAGC
GACGGAATCATGCCGTAGATCACCCCCACCGCGGCGTACTGTGCGAACAACCCAAACGCTTCTCGGGAAAACAGGTCGAGGGCCCCGCCTGCGACGATGG
CACCACCTTCCAGCTCACCCGGTGTCTT