Description :
From Genome Similarity Track
Location :
Scaffold_865:33- 1036
Sequence
1003 bases(100 bases per row)
GGGTGCGAGACACCATGGCGCAAGCCCAAGATAAACAGAAGGAGTACTCTGACCGAAATGGAAGAGGAAACATGAACGTGTTTAAGGTTGGGGATTTAGT
TCTCCTAGATATTAGAAACCTACCGCTAAACACTGTTAGCTCGGTCGAGAGCAACAAGCTGAAGCACCGCTTCATTGGACCCTTCACGGTCCTCAGCCGG
CATGGCGCGGCGTACACCATAGACTTGCCCAAGTCGATGACGACTCACCCGACGTTTTACGTGGGTCGTCTTAAGAGGTACCATGACCCTCTGGCTCTGG
CTGCCCCGCAGGAAGCGGTGGGTGGCCCGGTGGAGAAGAGCGCAGCTCCTCGAAGCGCGGCGTCGGGTCGCGGTAAGGCGCCTGATACGCGCGCTGGTCG
TAAGACGGCGCGGCGTACATCGGAGCAGCATACGCATACGCAGGGGCCCCGAACGAGCCCTGGCCAAACTGGGCCTGATACGAGTGGGGCTGCTGCTGCT
CCGGATACGGCGCGTGGCCATGAAGCTCGGCCCGAAGGCCAGCGAGCTGGTTTCGCAGCGAGTCGTAAGACGATAGGTCGGCTCGACGATCCACACGGCC
ATGGAGACTGCGAGTTTCTTGATAGAGCGAGGCAACATCCTCACGGAGCCGCTCCACGGCACCAGGCTGACCAGCACGAGCGGCAGCCTCGCCACCAAGG
CCGACGCCAAGCGCGATCTCGAGGACGTACACACGGTCCTGGAGAAGACGAATCTCCTCTTGCTGCAGGGCCACCACCTGACTCGGGGCCCCAGCATACG
GCTGCGTCGCCTTAGGCTCGTAGCCATGGCCGTGCGAGGCCACCGCCGGCCCTCCTTTGATCGTATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNN