Description :
From Genome Similarity Track
Location :
Scaffold_18:329990- 332251
Sequence
2261 bases(100 bases per row)
GTCGGAGGCAATGCGTGTGGTGGAGGTACTGTCGAATTGACAAATATGCGTTGGCCCGTATAGGCTTCATTAATGCCATCCTATTTTTGTGCGTGCCTTT
AAACACCGTTTACGTATGGCAGGATGATAAGGGCGAAGAATATAACTAGTTTCCATATTATTATAATATTATCTAAGCATATAAATATAGTGCTGAAGTA
GTAATACTCTGCTCGTTTGATCTAGATCATGATATTACCAATAATGCCGAGCTACCAAAGACGTGTGCAATGAGTGGTGAGCACATAGTTAAAACACACG
TTCGTATTTAGACATAGACAGCAGAAGATAAATATGATCGTTTGCAGGATATTAATTATACTCAATTCAGTTCAACTTTACTATAACTTTGCATAAAACT
CTTCAGCTACCCGTACGTGTACGTATCAATGTAAGTAGCTTTTTCTGTGTCATTGCAAGCGCCGGTGACCTATCACACCTGGTAGCACTTTGTCGCCCGT
CAAAAGACTACGGACGTTCTATCAAGCGTGATCATATTAAATAATGAAGAGGACAGCTTTCACTCCATCCATGAAAACCACTACCATTTATGCCATGTTG
AATGGGATGTTGTCGAAAATAAGGGTTCGGTGATTGACCAACTAACCTTCGGCGTAAAGATGTAAGCTCTAGGGCCAGACGGCAACATGACCCCAATGAC
AAGTTCATCATCTAGAATGATTTGACATAGAACGGGAAACGATAACCTTGTTTTATCAACAAAGTTACCAATAATACGAGCTGTATAGGTAACAGGATAC
TCACTTTCGAGCGAGCGGCTGCTGTTACCGGGTCGATGCACATGTGTGAAACCGAAACCATAAAGATTGACTTCTCTAAGTACCAAAAATGTGAAGAAGA
CAACTGTTTAAAACGTTTCGTTGATCTAAACTATGCCATAATATCACGCTACATCGTTGGTGAAGAGATGAAAGTCACGTTAGCTCCGTCTAACTGGGCA
CGTGTCAGATCTTGGGCGTTAGGGCTCAAAGTTCACGACCCATACACTTTTGGCTCGTTGCAGTTCTTTGAGAAGCTACTGAGACGGATGTTTAGGCCAC
TGCAAGATGAGTTCAGGGATCTACCAGATCCAACGAATCTATAGCAGGGTACGTGCAATGTACGTGATAAGGTACAACACATAAGACACCTTTCAAGTTG
TATTAGGACCAATCCGGTCGATAAACACACGTTAATGACGTTGTTTATGCAAGGTCTTGTGGATGATCCCGTGATTCATACAGGCTCATGCAAAGTAGAA
CTCCTATAGACGACAGGAAGGCAAAGTCTTAGTGCCTACGTACCTTTGCTGTTTGAGAACGAAAACTCTCACTTTCCAAAGTTCATAAGTTGCAAAAAAG
TGATACATGTCAGAAGACGGGAAACTACGCACACAAGTGTTCCGATTCACGTCCAGTGTCTCGAACCTATAGACGTACAATTCTTATTCCGCCAATAATA
GCCAGGGAAGTGGGTCCAACGTTGTTGCAAAGAAGCACAACGTAACGGACAATCAAAACGGTCAGGGTCGGTAGGTACAAATTAATCGACTGAAATAGCA
CCGTACAGTCAGTTTGAAGGCCTCTCTGATAAAGATGATCCCAAAACACAATTAATGTGCTTAACTGCATCTGGTAATGAGGTTTTTCTCGTATAACCTT
TACGATCGAAGTGGCCAGAGGTATTTCACTTTGAGCTCTATTCTATTGTGGCACGTCGAACCACTTTTTACAACGCCAATCGATCGATAATCCCTTCAAC
GAGGATGAATGTCTTGCAACAGGCAAATATGTAACATTAGTAAAGCGTGTGTTATGGATCAGCTACAAACTATAAGAGGTTAAATATGACGATGACTTCA
TCGTACTAGACTTTGATGACAAATTCAAAATTCGACCTTGAATTTTTGTGGATCGAGAGGTACTAGACACAGTCAACTGGAAGAGTCGAACAGTCAAAAT
TCCTGTCGCTTGTTAAATAGATGACCATCTGATGACCATCTGGACCGTTCTCAATAGTTTTTATATGCTACCAGTGAGAGCGATGGCCTCACTTGTGGCT
CGGACGCTACTACGACTGCACTAGAGCAAATTTGTTTTACTAGCCATCACCCTGTGTAGCTATCTTTCGGTGACTGTGTACTAATACAGTAATCTCCAAA
GTTCCCACTACTCCAATAAGATGTGGGCCTATAGGGGAGCATTCATGCCCCCATTGCGGGA