Description :
From Genome Similarity Track
Location :
Scaffold_99:32993- 42308
Transcript NameFunction/comments
Phyci_237401Hypothetical protein
Phyci_83790Hypothetical protein
Phyci_12453Hypothetical protein
Phyci_283926calcyphosin, putative
Phyci_201438Hypothetical protein
Phyci_31056conserved unknown protein
Phyci_83793KLTH0E02420p

Sequence
9315 bases(100 bases per row)
ATTCTGGACAACGAGTTGAACAAGACGGATTAGTCGAACAAGATACTGCTGACATAGGAACGCACAGTGTCGAGCACGTGGTGTGTGGTGGCCGCCAGAC
AATTGCTTTCAGCTCTGGAAGTTTTCTTGCTCGTTCGATGGCCAACCTCTATCGAGAGTCCATATTTCACGCAAAACTTGGCGACGTACACCAAACGACA
GCTATAACAGGCGCTGATCTCGTTTTGATGGTCTCAGGTCAGCGTGTTTTGGTACACAAGTTGCTGCTTGCCCAGCGGAGTCCCGTCCTCCGTGAACTCA
TTTTGGACGAAGAGCAACAACAACAGAACCGCCTCGATGGAGCTGATGGTGATGTAAGCAGTCGTACCGTATCTCGGATGGAATTGCTACTTCCTCGACT
ACGAGTTGACGTTGCTAGAGCGCTGGTGGAATTTATTTACACGGATAATTTTTCGATAGAGGTGAGCAAGACCTCCATCTATCTAGTGAACGACGTTCTG
CGAGCGGCGAAACTCTACAAACTGCCTGGCCTCACACGACTCTGCCATGAACGTCTTCGTTCAGCATCGCCATCGTCGCTATTTGGTGCATCTACTCCTC
ATGTGCTCGACGAGATTGATGAGGGCCACGACGAGCTTAGTGACACCGATAGGGAAGGAGATATGGACGGCGAAGACATCGATAGCAGCAATGCTGCTTC
TCGCACATTGAATGACGACATGAGATTCGCTTTGAGTGACGTGATATGGGCGGATACAGTGCTGGTGGCGGAAGGGCGACCGATTCCAGTTCATCGATGT
ATGCTGGTAGCCCGAAGCGAGTATTTTCGAGCAGTACTTACATTCCAGCACTCCACAACCTATGTCAAGGATGGTATGGATGCCGATAAAGCGGTCGTCA
ACGTCGAAGACACGTACGCAGGAATCGTTCGAGTTCTACGTTTCATTTACTACGATCAGGTCGCACTACCAGCATATAAGGGGGAGATTGCTACAAGGCC
GACAACCAACAACACTAGCAGTAGTGAAAACAAAGTAGCAAGTAATGCTGAGGAAGAAGCAAGTGATCAGTTATTGGAGGACCTCGTGGCCGCGGACAAG
TACGGACTAGAGCGTATGAAGCGACTGTGCGAGCATGCAATCAATGTGACTATAGAGAACAGCCTGGAAGTACTAGCGGTGGCCGAGCTAGTGCACGCCG
CACACCTGAAGCAGGTCGCAATGCGATTCGTGCAGACACACCTAGCAGCTGTTACAGCTCGTCAAGAGGAATTCCAACGTTTCCAGGACGACTTCCCACA
GCTTTTGGAACAACTGTACGCCAGTCTTCGCGATGCAAGTCGAGACGAATTTCTTCTACGTGTAAGTAACAGTATTGAGGGTAGGTCGTGCGTTTAAACT
AACGAGTTCATTTGCTGGCAGGAATGGCACAAAGACGTTGGATCAAGCTTAGCCGCCCAGCGTGAAGAAGAAGAGCTTGAGTGGGGCAAAAAATCTGCGG
TATCCTTCCCATGGGTACCTCTAAGCTTGGCTGTGGCGTTCGGCACCATGTTTCTATCCCTGATGCACTCTGAAGAACATGAGTATTCTGCTGTCCCAGC
GACCAACCTCGTTGCGATTGTCGCTATCGGCGGAGCTATTACCATGGGGTATCTGTAGAATCGTCCAGGGAGAGTAAGACCTTCAGACATGTATTGAGTA
TTACACGTAAGACTTGACCAACCAACTCAGGCGATCTTTCGTGCCAAGGAAGCTTTTACACGTCGCGAACGTAGTGCGACGCAGTGTTCCGAGGGTTACC
CGTGAATTCGTCGCGCCAATCCAGCCGAATGCTGTCCATTTTCGCACAAAGTGAGTCTTTCTTGCGCTCTAAGGCGGTCAGCTCTTCATTCTTAATTTGA
AACTTCTTCTCGAGAAAATCGAGTTCAGACGTATGGGAAGACCTGTCCCCGGCCCGGACAGCGCTAGCCCAATTGACTCGTTTGGCCTTCAAGTCGTGGC
GAACTTCGCCGATTTCGAATTGCTTGAGCTCGATGAGATGCGTCGTTTTCTGCAGATTGAACCGAGTTCTTATCTCGCATTGTAGGCTTTCACATTCCGC
CAAATGCTCCTCAACTCGCTTCCAAATACCGCACAGCCCAGTTTCTCCGGTCATCTGCTCCTGACGCTCGATACAAGCCCTAGAGCAAATGTACCCCACT
GGAGGTTCGCAATATTTTGCGTCGATGAGCTCGTTGGCCTTTTGAATCCACGTTTTGATGGTCTCGAACTGCCCTGGTGACTTTGGCTTGAGCAAACAGA
GGTCCCCAACTTCATCTTCATTCGCCTCCGTGGTTTTCAGTCCTGGGTGTGATTTTTTCTCAATTGGGGCTGCAGGTCCCTTACCATTCAGTTGATGTTG
CTTGCAGGCCTGTGTCGGCTGTAATTCTTCACCCGTGTTAGACGCAGATTTGTTCTCTTCATCAGATGAGTTGGAATCATCCTCACGTTGAACCTGCCGA
TGGCGCTTAGAAAGCACTCTGACCTGCGAAAACTTTCTCTTCCCCAGCATCTGCGGCGTCGAATCCAGCTTTGCTGAACTCATTGAATCTTCGTTGTCGA
CTTGCTCGTCGAAGTCGGGATTCTTACGGCGACGGAGCCAGACGCTTTTCTTTAGCACCGAGTCGAGTATAGCTTTTGACGCGTTGTTGCGTGATGCAAG
GATTACGTAATTCATTTGCTCGAGAAAATCTGGGGACGTGTCCATGGTGTTGGCGATATACTCAACGAGCTGGTGACAGTTGTCATAATAGCGATCAAAC
CCTGCAGCGTCCCCACCAAGGTCTGTTCCAGGCATTGGTGTTCCCAAATCCAAGCTTTTTTCAAAGTCAGCACACACTGAGTTAATAGTTGTATTCATAC
GCGATCTCAACGACCGCTTCAGGTCGTCCTTGATCTTGTCAACCATCACAACAAGCAGCTTATCAGCACCTTGAGATTTTTCAGAAGTGAGATTGACAGA
CCATCGCGGAGAAAAAAACACGTAGATTGATGGTAACAGACTTAGCGGTTGTCGTGCTTGATGTTCCAGAGTAGCGCCATAAACCCCACCACTCGGAAGC
CGACACTAAGTGCAAGGAGCAGTAATCCGTCTCCAAAAGCCGAACGACCGTGCATACTATAGTTGGTCAGCACTTCCGCCCCTGAACGCGCCAAGCAACT
CTGTGACGTACATGAGATTACTCCGACCTCACTCCAGAACACTTTCATAAGTCCTTCGAAGCCATATTTTAGAGGAGAGAGAAACTCGAGCCAGATCAGA
TAAACTGGGATGTCCTCCGAGTTGATTAGCAACCCGGCCAGCAGCACCATGGGCATCAGCAACACGATTCCTATGGTAGGGGCAATGTCAGCTCGCTGAC
AAATGCATGGAATCATATAGCCGAATCCCACGGCGGCGCTATGTACAAGTATCACGATTATTTGCTGGTACATGTACACAGGCGCGCCGTAGCCGATGCC
GATCATGAAGTAGACCGGCACGAAAAACACCATTGGCAGTAGAATTTGCATTGGGAGCTCGCTGATGTTCTTCGCCAGATACCATGACGTCACGTGATAA
AGCCCGCTTTGGTACTCGCGTGCAATAAGGGTACGCTCTAAGGGCACCGAGGTGAACTGTCCGTTGGCCGTGATCATTGTTTGGCTGACAACCATGAAGA
AGAAGACGCCAACGAAGTTCTGTACTCCAGTCTGACCCAAGTCCAACTGCAAGTATACAAGCCCCACGATAACAGCCGTCATGAAAGACTGCATCATGGA
AACCCGAAGCAAGAGCTTATCCCGTAGCAAGCGCACTACATTCCGCTGCAAAAGAACGAGCGTTTGCGAGACACCACCAAGGTGTTTACTTTTACCAGTG
AAGCGCGAAGATTGACCTGTTTCAGACGCAGCCAGAGTCATATCCTGGGATTTCTTCCACGAATCAATTAGAGTCTGCACGCGCTGGGCCCCAGCTCGAT
CGTTCTCGGCGTCTAGTACAGCAAGTTGACGCATGAAATGCTCCGCTGGGTTTGAAAACGCTGGACACGGGTATCCTTGAGAGTTAAAGTAATCGAGGGC
ATCTTTGGCTGGCCCATCGTAcaccactgagccattcgccatcagatacagccgatcgaagcgcccaaatatgtccgaggacggctggtgaatcgtggtc
agtacagtcttcccctgtcgagcgatgcgctgcaactgcatcacgactgactcggccatgaagctgtccagtccagacgtaggttcgtccacaaagaaga
tcaatggatcgcccagaatctccgcagctagcgacaacctcttcctctctccacccgagatgctgcggacgCGAGCACCTCCAATTAATGCGCTCGACAC
CTTTGCCAGGCCGAATCACGCATGGCCTTGTCAACACGACGCACAACCTCTTCGTTTGAGACGACGTCACCAAGTCGTAGCTTGCCTTGGAAGATCAAGT
GTTCCCGAACCGTCAGCGTCTCGTAGAAGAGGTCGTCCTGCACCACGTATGTCATCACCGCCTTCATGTTGGCATTAAGTGTCACCCCGTTCACAGCCAC
ACGACCAGTAGCTCCTCTGTTCCTTCcagccaaacagtcaagcagcgacgtcttgcccgcccccgacggccccatcagcaccaacagctctccagagcgt
gcagctccactcaaatcgtccagaatggtcttctGCTGTGGTCCAGCGGGGTCCTTGCTCACTTTTGTCGTGGACACCTCCACCTTCAGACACAAGTGCT
GCCATTCCAGCACACAGGGCATTGGGTCCGAAGGCCTGACGACCAGTGACTCCGGCTCCCGAGTCGAACATCCATCGTCCACTTCGATATCCATTGGCGA
CTCAATCCGCACGAACACTTCCGGTGAAGGTGGCGGCGAGGACGAGGACGATCGGTTCGACATTTTGGATACCCGAACGCTTGGTTATCTGCGACCGTGG
CCGGAAGAACACAAGTGGTAGAGTGGACATGAAGAGAAGGGGGGCAGCCATGTTGGTTCTATGCGTCGTCGTCATAGTGGACAAGATGAGCCAGCTTATT
GAGCTAGTGATAAGCCTACGATGTCTCGGTGTCCCTGTGCCGCGAGCTTCTCCATTATGCGACGAGTGTCCGACGCGGCGATGCCCAGATCATTCTCGAT
CTCGAGGACGCGCTGGGAACCGTCTCGGAAGGTGGCCAACACCCGTCGGCAGGAGGAATTGGCGCTCCATCCTGTGCCGCCACTGAGGTGCCACGCATTG
CGCACCATGAGCTCGAACTCGTCGTCGTTGGCGATGCCGGCGCTCAGATCCTTGTAGTACTCGAGGAACTCGTGCCAGGTGATGACTCCGTCGCCGCGTG
AATCCGACTGCTCGAAGACAGCCATCATCTCGAGCATTGCGTCGCGTGGCTTCATTCTTCCGCCGAGTACCTCAGGGTGCTGGGAGGCGTCGTACAAGCG
CTGCACCTCGTCAATGGTTGCATTTCCATCACCAGAAGTGTCCAAGAGGGCGAAGGCCTTCTTCACGAGCAGGATGCGGCGTTTAACCATCGAACCCTAC
GCCAACAAAAGAGTCAGGTGCTGGTAAAACGGAATCGGTGTCTGCTAGGTGCGTACCCGAAGTCCACGCATGAGCTCATCAATGGTGATCTTGCCGCTCT
GGTCTCGGTCGAAGTAACGGAAGGTGCGCTCCACTTCTTCTGGATCAACGTCGCGAATGCCCAACTGGGCGATACCATCGCGGAACTCCTGACAAGTGGC
ATACTTTCGTCAGGTGACAAGCCCGACCGAAGATGTCAAGTAATTCCCAGTGAACGCACCTCTAGCTCGATCATGCCGTTACTGTTCTGATCCATTCGCC
GCAGCATGACGCCCAGCGTGCGGATGCCGTTCTTGCCTCCTGCGTCCAGTATGCTTTCGCGTACGTACTCGAGAAGCGACCGAGCTCTTCCGGTTAGCGG
TACTCGTCCGGACACTCCAGTGACTGCTCGAGCAAACTCGGCGTAGCTGAGAACCCCGTTTAGATCCGCGTCGTAGCGATCGAAGAGAGCTTCCGTTTCA
GCTTGCACCCCGACGAAGTTGAGCGACAGCATCGCACGCGCGAACTCGTCGAAGTCCAGGACGCCTGATCCATCACGGTCGAAGGTGCGGAAGTGCTTAG
CCAGCATCGTTGCCTGGCTGTGCTCGTCGCGGTAGCCCGACCGCACCTCGAACATCTCGCGGAGCTTGGCTTCCATCGCATCAACTCTGTCATCGCTCAT
ATTGCCGCGTGCTCGAGTTGAAAAGTACTCGACGGAAGCGTCGCTCTCTGGAGTAACGTACGAATCGGTTTGAGTTTCTAGAAGAACTCTTCTTCTAGCA
TTTCAAGCACCAGCTCACGAAAACGACACAAGTGAAAGACAGCAATTCCTGTTTCGCTACCTGTGAAAACAAAACGAAAGGATCCAGAAGCATCGTCGGG
CAATACGGTATTCACCTGCAATTGTACGACAGATTAACATCAGGCAGGGGCGCGAAAAAGAAGTTACCGGTAGCATAACGCATGCCATTGATCACGATGA
CTGGGCACGAGGACGTAATCTCCGCGCTATTTACTACTTCTATCCACTTTGGCATCGTTTTCAGCAAAAGTGACCGGATACCCAACGATTCTCATCCTAA
AATTTATCCTAGATCGAGCGTTTGTCGTTGGTCGCTTGAAGTTTCACCGACCAAAGCCGAGATTTTATCTCGTGGCACCAGGGTGGTCATTTCTAAATTC
GCAGAAGCAAAGCCACCCGTATCGTGTCGAGATGAAGTTTGTCGTCGTCCTCGCTCTAGCTGTCTTCGGGTCCGCCTCTGTCGAAGCAGGCAGACCGCTC
ACACTCATCGCCGAGCCTGCCTGGGATTCCGCGCCATATTCAGGCGACTCGTCCAGTTCCAGTGCTACGAACTGCCCCACTGCATGCTTTGCTGTGATGA
GGCCCGTGTACGATGCCAACGGCGTGAGATATCCGAACGAGTGCGTGATGCGTCGCGAGAAGTGCAAGCAGAAGCCCAAGAGCATGGAGGACATCTTCGC
CGAGTACGAAAAGCTCTACCGCAAGCCTTTCGGTGCCGACTCTGGCATTGGCGGTAGTGCCAGCAGCGGCAGCAGTAGCGCTAAGGACAACGACTGTCCA
TCCTTTTGCTTCGACGTCTACAGGCCCGTTCGCGACGAACAGGGCAATGTGTATTCGAACGAGTGCTACATGAAGCGCACCAAGTGCAGGGCTAAGGAAG
AGAAGCTTGACAGAAACTCGTTGCGTGGCATGACGAAGCAGGAATCGAGCTATTACAGGCAACTGCAATGGCTAGAACAATCAAAACGTTGTATCATCTT
GGTGGAAAGTAGTGACATCAACCAAGTCTTGAGTAACAAAACTTTTCTTGAGTTTTCCAAGACTTCGACGCGTAACTTGTGTTTTACTCCTGCTTCTCCT
GCAGCATCTTCTTGAGCTGCTGGTTCTGCTGGGCCACGTACTTGGCGTTGCTGCCGGCGGCGCGGCGGATCTCCGTCTCCTGCACATCGTCAAAACAATT
ATTGTGTTATATTTAATAACAAAACAATAATTGAGCTCATTGTCCTCAAATAAATAATTGTACCTCACGCTGGAAGTTGGCGTCGGCGCGGCGCTCCGCC
CACTTCATGACGTAGTAGCCACCGATGATGGGCGTCGCGAAGTACACGAGGCCCATGACGCGCTGCCCGTTCTTGGACAGCGGGATGCGCGTGCTGTGAA
TCTTCTTCTTGAGCGCCTCGTGGCGCTCGCCGAGCTGCCGGAAGAAGTCCATCGTCGCCCTCAAATAGGAAATGACACGCATGGAAACGCCTCAAATTAT
TTAGCACAATTATGGCCGAATTATGCAGAGTACGGTACTACGTACCACGAAGCGACGCGAGCCGGCTTCAACTTGGTGTCATCGAGATGGAAGGCGAGGA
CAATGCTGAGGAGCAGTATGCTGCAGGTGAGGATGTGGTTGATAGGCACACAGTAGCATTATCACGTTGCTACTCATGTTGGGTCTGACAATTCTGCTAT
GAACAGAAGGAAGGTGCATGTATCCGGAAAGCTACGAAGCCAGTAGTTACGCGGACTACTACTACCAGCAGCAAGATGGAGAAGCAGCACAAGACTATAG
TTCGCACCATCAGCAAGAGTACAGTGGATACTACTCACAACAAGACTATGATGGGTACTATGATCAGCAAGATCCTTCTGCAGTGGATCCGTACCAGTAC
AGCTATGACACTGCTGCTTCTGCTGGAGGGTCTGAGGCTCAGGGCTACGAGCATTATGCTACAGGAGAGGGGTATGGAGACGGGCAACAGCTACAAGCAG
CGGAGACACAGGAGTCTTACTACGCAGAAGAACACCAGCAGCTGCACCTGGACCAACTCACGGCGGAGCAGACGACCGGGTACTACTACGATGAGGAAGG
GAACTTGGTTGGGGTGCCAGAGTCGCCGACGAATGTATTTAGCCAGGAAACATACTGGGAGTCGGGGCAGAACAGCAGCAACGCGCCGTACAGTGGGGAT
CCGACGGACCCTGGGTCGAAAGAGAGGAGTCCTCAAGATGAGACGGACACCGAAGGTCTGGGAAATACAGATTCAGCTCCCGTTGACCCCGCCGCAGCTG
AAGGGTCTGACACTGTAGCAACGCCAGACGGGAAGTCGCCAAAGAAAAAGAAGGCAAGCCCGAATGGTAGAGCTACGTCGCCGTCGAGGAAAAAGGTGAG
TTTCTAGACGAAACATGCTGGGATTCCAGTGTTCGTGGCGTCATCCGGTTTGCTGTTTGATACAGAAAACGAAGAAACAGCGAATTCAAAAGAGACAAGA
AATGCTAGAAATGGAGGAGGGGGAGCGACTGAGAGCGCAAGAAGTCACAGAAGCCGCAGCTGCTGGTAACAATGCACCAGGAGATACCATTGGCGCTGCC
TCCAAAGCGCCGAAACTGTCCAAGAAAAAGACTGGATTCGTGGATCGAGAGAAGGCAAAATTCCAGCTGAAGATGCGTATTGTTAAGGCCATCAAACGAA
CCCGCATGCCGGTCCAAATCCGAATCCTCCCAACTGTAGCGTTTGCTGAGTGCACGGCTCAGTGCTTACTATCAGTGCTAACTAAACGTGTTTGCTTTTC
ATGCCGTAGACACGAAAGCATCTGTCGCCGATGGATAAATATTTTGGTAGCTCGAGTGTTGAGTCCATTCTGTCTGACATTTTCTGGGCGGCGATAAAGG
GGGATATCGGGCGAG