Description :
From Genome Similarity Track
Location :
Scaffold_177:32993- 36712
Transcript NameFunction/comments
Pytve_DAOMBR484fgenesh_masked-pve_contig_177-abinit-gene-0.47Conserved gene of unknown function
Pytve_DAOMBR484maker-pve_contig_177-fgenesh-gene-0.4Syntaxin 7

Sequence
3719 bases(100 bases per row)
CCAGCTGCAGTCCCCGCGTATTAGAGCCCACCGCCGAGAATGAGCGACCGGTACCGGGCGGCGTCGTCGCCGCGCGACTCGGAGATGCAGGACGACCGGT
TCCAGAAGCTGGTGGGCGAGACGTCCAAGGGCATCTCGAGCTTCAACCAGGTCACGCGCAGCATCGCGCAGAAGATGTCGCTGTTCGGCACGCCGCAGGA
CTCGCGCGCCAACCACTCGCAGCTCAAGGAGCTGACGGACAAGGGCCACAAGCTCACGAACAAGCTCAACCGGCGGCTGCAGGAGCTGCACAAGGCCACA
CAGGGGGCCAACGCGTCTCCAGCGCTGCGCGCACGCAAGGCGCAGGTCAAGAAGCTCTCGGGCGACTTCAAGACGCAGCTCAAGTCGTTCGAGGACACGT
GCACGCGGCTGCTGGAGGCCGAGCGCTTCTCGGTGGACCTCATCCGGCGCTCCTCGCAGTCATTCCGCTCGGACGACAAGCCCACGGGGGCCGCCTTCGC
CAACTACAGCGAGGACCAGATCTACGCGCAGGCCAACGTGATCGTCTACGACGAGGACGGTGCGGACTGTCCGCTTTATTGAGATGTGTGTGACTTGAGA
CTAATGCTGTTCCTGTTGTGACAGACATGATCCGGCGCGAGGAGGACATTATCCAGATCAATCACCAGCTGCGCGAGGTCAACGCGGCGTTCCAGGAGAT
CGACGGGCTCGTGCAGGACCAGGGCGAGGTCGTCGGTACGGATACGCTAGCTCCATCTCATGCCATGTTGTGAGGAACTCGACTCACCACGAGCTGTATT
TTGACAGTCGAGATCGCCGACAACACCGAGACGGCCAAGGACAACGTCGAGAAGGCGCTGAACCAGGTCAAGCAGGCCGACGAGCGCGCGCGCTACTGCG
CGTGCTCCCGCACCAAGATGATGTGCTACGCCGTCTTCGTCGTCATCCTGCTGCTGCTGCTGCTCGGCATCATCGTCGCCGTCGCATGAGCCTCGCTCTC
ATTTCGCTCGATAACAGGTTGCCGTGTATACATATACCCCTCGTGCCGTGTGTGTGCGTTGTCAGATGTCCGCTCGCGCGCTCTCTCACCCCGCCGAATC
CTTCACGACCCCGCTCTGCCTCCGCTTGACGCGCGCGCCGTTCTCGGTCTGCAGCATGGACGATCGACGCGTTTTGGTATCGTCCGCGTCGTGCTTTCGA
CCGAACAGGCTCTCGGCCATCGAGTTGAAGAGTTGGCCGACCGCTTCGCCCGTCGACTTGCGCCTCTGTACTGCCGGATCCCTGTCGCCAATTGCAGCGG
CGACGGCGGCGGCGACAACCTGCGAGTCATTCGCACCGTCGGGTCGGAAAGCGAGCGAGCCGCCACCGGAGGACGAGCCCATCTTGCCACCGCGAGCCTG
GAATCGTGCTCGTGCATCGACCGAAAACATGTGCGCGAACGGCACGGCGGAGTCGCGCTCGCCCGAGTCGAAGAGCACCTGGCATATGCGCTCCTTGTCG
CGCACCAGCTCGACGGCGCCGTAAAAGTACGTCGCGCTGCCGTGCACACGGGCGAGCACGGCCTCGCCCACCGCGAACGCCACGGCCCACAGCTCGAAGC
CGAGCGTGTCGAACGTGAAGTTGGTGAGCTTCTGCATCTGCGGCAGCGCGTCGGTGTCGTCGAGCCTCGCGAGCCGGTCGCGCGAGACGTTGGCGCGCTG
CTCCCCATAGTCAAAGGCGACGGCCCAGCCAGACTCGCCGCGCGCCGTCACCTTGGCCGAGCAGAAACGAGAGAAGCGAGAGCTCCACGCCAGCACGTAC
TCGCCCACGCCAGGCTCCCACGCCGCTCTCGACGCTCGCCGAGACGCCTTCCGCTTTTGGTCGAGCACCATCTGCGACGGGAACACCTCGAGCGCGATCG
TGCCGTCCGAGAAGCGCAGGTCGCAAGCCCCCGACATATGCGTGCGGATGACCAGGCAGCTCTCGATCGTCTGCTTGCGTGGATGGTCCGCCTTGACCTG
GTACCCTTCCTCCAGCTCGAGCTCGAGCGCGTCGCCGTCGCTGTCGCGCAGCCGCAGCTGCGTGAGCACGGCGTTCTTGAGCCGCAGGACATCCAGTTCG
TCGGCAGTCGACGACGCGCGCGGCTTCTTGCGCTTGACGATGCGGTTCGGCGCGATCTCGTAGCCCGTCGACCCGTCTGCAAAGTCCACGGCCGCCGTGC
GGTTGCTGTACACGCCGTTGAGCACGCCGAGCTTCTCCTCGACGCTGCCGTCGCCGCACTCAGCCACGCACTTGACGAACACCTGGTCGCCAACGAACAC
CTTGGTCTTCCCGGCACAAATGAGGAAGTGGTCGTCCGTGATCATCGCGCGCTGCCTCTTCCTCTCGCGCAGAGGCACGAGCTTGTCGGCTGGCACGTTC
AGCAGCCGCAGTCGGTTGGCCAGCAGCACGTGGAAGCGCGGCTCGTCCCCAGGCGCGTCCGCCGGCCGCTCGGCCGTGACTAGCCCATTCCCGGAGAAGC
GGCTGCCAGGGTACAGCGTCACCTGCACGGTGCGGCCGGCGAACAACTCCTTGGCGGCGTGCGCGAGGCTGTCGACCTGCGTCTCGAGCTCGCGCGTGGA
CGGGAGGAAGTCGAGCTTGGAGGCAGACAGCGCCTCCACCGTGATCATCTGCTCGTCCTCGGTCACAACGGCGAACTCGCCCGTCGGCAGCTGCGACTTG
ACAGTGCCGTAGGCGCGCACACCGTCCGATCCCCGCTCGTACACCACCCGACTGCCGGCGATCGTCGACATGTCGACCGGAGACGGAGTCTCGAGCAGAT
CGTCCAGGTTGACGAGCATGCGCGCGAGGTGGTCGCGCTGCGTCGTGGACTGCAGCGATGACGCGTCAAGTGCGGCCGGCTGCACGCGCCGCTTGCGGGC
CAGGTAGTCGGTCACGAACTGCTTGAACGTGCGCGGGCGGAGCAGGCTGGTCACGCTCGCATGCTGCGAGGCCCGCTCGACCTGCGAGACGCTCGAGATG
CTCGACCGCCGCGCTCCCCGCGGTCGGACCGCGGCCTTGGTCATGCCGAACGTCTGCGTCATCTGCTGCCACGGGGTCATGAGGCTGCCGTCCTCGTCGT
CGCTCGAGTCGTCCGAGTCGCTCACTTGCGTCGAGTCCTCCTCGAACGCCACGCCGCCCTCGAGCTGCTTCATGAAGACCGTCTCGTCCTGGATGACGAG
GCTCTCCGCGTGTAGATTCTCGCCTTGTTGTTCGTCCTGGCCCACTGCCTGGACCTCGGGGTGATCGGGTGGACCGGCCAGGATCAGGAAGGCACTGCGA
GGCGGATTGACCGAGAAGTCGACAAGCAGCTGCTGACCCGGCGGCGCCAGCTCATTCGCATTGCCAGTCGCCGTAGTCTCCGATGACGTTGAACCTCGCC
GCTGGTCTTGATTGAAGCTGGAAATGCGTGATTGTCCCGTACTGGCGGTCGAATTAGGATCATTGGTGGTTGAGGCACTGACCTCCTGGACGTCTTTGGC
GATCCGCACCATGATGTCCTCGCGCTTGATGTGATAGTCGAGCGCGCCGTCGTCGAAGACAACCATGAAGAGCCCCGCGCCGAGGTACGTGGCGATGTTG
CCCGAGTAAAAGTACGGCGTCTTGCGGAACCGCGCGAGCACGGGCTGGCCGTACTGCCATCTTCCGCGCAGCGGCTCAAACCGGCCCGTCGAGCCCACGG
TCACCGGCGGAGACGCACT